EMAIL THIS PAGE TO A FRIEND

AVPR1B

arginine vasopressin receptor 1B

60 Gene Product Result for
Synonyms: AVPR3
UniProtKB ID: P47901, B0M0J6, Q5TZ00
Gene ID:
Human(553) Summary: The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
Mouse(26361) arginine vasopressin receptor 1B
Rat(29462) arginine vasopressin receptor 1B
Zebrafish(555939) arginine vasopressin receptor 1B
cow(282861) arginine vasopressin receptor 1B
Horse(100055260) arginine vasopressin receptor 1B
domestic cat(101088713) arginine vasopressin receptor 1B
dog(488578) arginine vasopressin receptor 1B
chicken(428263) arginine vasopressin receptor 1B
naked mole-rat(101699528) arginine vasopressin receptor 1B
domestic guinea pig(100717018) arginine vasopressin receptor 1B
sheep(443050) arginine vasopressin receptor 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
V2257 [deamino-Cys1, D-3-Pyridyl-Ala2, Arg8]-Vasopressin ≥97% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000707 Rosetta Predictions human pricing
NM_017205 Rosetta Predictions rat pricing
NM_011924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303110 predicted 1530
2 SASI_Hs01_00096524 predicted 812
3 SASI_Hs01_00096526 predicted 816
4 SASI_Hs01_00096527 predicted 1463
5 SASI_Hs01_00096528 predicted 519
6 SASI_Hs01_00096529 predicted 351
7 SASI_Hs02_00303111 predicted 1540
8 SASI_Hs01_00096530 predicted 979
9 SASI_Hs01_00096531 predicted 365
10 SASI_Hs01_00096532 predicted 991
11 SASI_Hs01_00096525 predicted 1982
12 SASI_Hs01_00096533 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070490 predicted 361
2 SASI_Rn01_00070491 predicted 509
3 SASI_Rn01_00070492 predicted 257
4 SASI_Rn01_00070493 predicted 816
5 SASI_Rn01_00070494 predicted 606
6 SASI_Rn01_00070495 predicted 1153
7 SASI_Rn01_00070496 predicted 975
8 SASI_Rn01_00070497 predicted 250
9 SASI_Rn01_00070498 predicted 543
10 SASI_Rn01_00070499 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176900 predicted 2141
2 SASI_Mm01_00176901 predicted 968
3 SASI_Mm01_00176902 predicted 1499
4 SASI_Mm01_00176903 predicted 1556
5 SASI_Mm01_00176904 predicted 2157
6 SASI_Mm01_00176905 predicted 2033
7 SASI_Mm01_00176906 predicted 1773
8 SASI_Mm01_00176907 predicted 1431
9 SASI_Mm01_00176908 predicted 2003
10 SASI_Mm01_00176909 predicted 1424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000707
AVPR1B MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin receptor 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-822s21c1
Sequence:CCGGATCTGCCATGAGATCTGTAAACTCGAGTTTACAGATCTCATGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-991s21c1
Sequence:CCGGGAACAGTGAAGATGACCTTTGCTCGAGCAAAGGTCATCTTCACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000707.3-1516s21c1
Sequence:CCGGGAGGGTAAGGGTTGGAGTTAGCTCGAGCTAACTCCAACCCTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-1110s21c1
Sequence:CCGGGTGGCTTTCACCATCTCTATGCTCGAGCATAGAGATGGTGAAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-1428s1c1
Sequence:CCGGCCTGATGAAGATTCCACCAATCTCGAGATTGGTGGAATCTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000707.2-1955s1c1
Sequence:CCGGGCTGCCTCATAAGCTCCCAATCTCGAGATTGGGAGCTTATGAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-991s1c1
Sequence:CCGGGCCTCCCTCAAGTCTTCATTTCTCGAGAAATGAAGACTTGAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-1329s1c1
Sequence:CCGGCGAACAGTGAAGATGACCTTTCTCGAGAAAGGTCATCTTCACTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000707
AVPR1B MISSION shRNA shRNA Plasmid DNA
arginine vasopressin receptor 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-822s21c1
Sequence:CCGGATCTGCCATGAGATCTGTAAACTCGAGTTTACAGATCTCATGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-991s21c1
Sequence:CCGGGAACAGTGAAGATGACCTTTGCTCGAGCAAAGGTCATCTTCACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000707.3-1516s21c1
Sequence:CCGGGAGGGTAAGGGTTGGAGTTAGCTCGAGCTAACTCCAACCCTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-1110s21c1
Sequence:CCGGGTGGCTTTCACCATCTCTATGCTCGAGCATAGAGATGGTGAAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-1428s1c1
Sequence:CCGGCCTGATGAAGATTCCACCAATCTCGAGATTGGTGGAATCTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000707.2-1955s1c1
Sequence:CCGGGCTGCCTCATAAGCTCCCAATCTCGAGATTGGGAGCTTATGAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-991s1c1
Sequence:CCGGGCCTCCCTCAAGTCTTCATTTCTCGAGAAATGAAGACTTGAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-1329s1c1
Sequence:CCGGCGAACAGTGAAGATGACCTTTCTCGAGAAAGGTCATCTTCACTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000707
AVPR1B MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin receptor 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-822s21c1
Sequence:CCGGATCTGCCATGAGATCTGTAAACTCGAGTTTACAGATCTCATGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-991s21c1
Sequence:CCGGGAACAGTGAAGATGACCTTTGCTCGAGCAAAGGTCATCTTCACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000707.3-1516s21c1
Sequence:CCGGGAGGGTAAGGGTTGGAGTTAGCTCGAGCTAACTCCAACCCTTACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000707.3-1110s21c1
Sequence:CCGGGTGGCTTTCACCATCTCTATGCTCGAGCATAGAGATGGTGAAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-1428s1c1
Sequence:CCGGCCTGATGAAGATTCCACCAATCTCGAGATTGGTGGAATCTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000707.2-1955s1c1
Sequence:CCGGGCTGCCTCATAAGCTCCCAATCTCGAGATTGGGAGCTTATGAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-991s1c1
Sequence:CCGGGCCTCCCTCAAGTCTTCATTTCTCGAGAAATGAAGACTTGAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000707.2-1329s1c1
Sequence:CCGGCGAACAGTGAAGATGACCTTTCTCGAGAAAGGTCATCTTCACTGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011924
AVPR1B MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin receptor 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-493s1c1
Sequence:CCGGAGCCTCCCTCAAGTGTTCATTCTCGAGAATGAACACTTGAGGGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-348s1c1
Sequence:CCGGCAGCATGTTTGCTTCCACTTACTCGAGTAAGTGGAAGCAAACATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-207s1c1
Sequence:CCGGGCATCTGTTCGTGCTGCACTTCTCGAGAAGTGCAGCACGAACAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-549s1c1
Sequence:CCGGGCTGGACTGCTGGGCAGATTTCTCGAGAAATCTGCCCAGCAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-922s1c1
Sequence:CCGGCCTAATGAAGATTCTACCAATCTCGAGATTGGTAGAATCTTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011924
AVPR1B MISSION shRNA shRNA Plasmid DNA
arginine vasopressin receptor 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-493s1c1
Sequence:CCGGAGCCTCCCTCAAGTGTTCATTCTCGAGAATGAACACTTGAGGGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-348s1c1
Sequence:CCGGCAGCATGTTTGCTTCCACTTACTCGAGTAAGTGGAAGCAAACATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-207s1c1
Sequence:CCGGGCATCTGTTCGTGCTGCACTTCTCGAGAAGTGCAGCACGAACAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-549s1c1
Sequence:CCGGGCTGGACTGCTGGGCAGATTTCTCGAGAAATCTGCCCAGCAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-922s1c1
Sequence:CCGGCCTAATGAAGATTCTACCAATCTCGAGATTGGTAGAATCTTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011924
AVPR1B MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin receptor 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-493s1c1
Sequence:CCGGAGCCTCCCTCAAGTGTTCATTCTCGAGAATGAACACTTGAGGGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-348s1c1
Sequence:CCGGCAGCATGTTTGCTTCCACTTACTCGAGTAAGTGGAAGCAAACATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-207s1c1
Sequence:CCGGGCATCTGTTCGTGCTGCACTTCTCGAGAAGTGCAGCACGAACAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-549s1c1
Sequence:CCGGGCTGGACTGCTGGGCAGATTTCTCGAGAAATCTGCCCAGCAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011924.1-922s1c1
Sequence:CCGGCCTAATGAAGATTCTACCAATCTCGAGATTGGTAGAATCTTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks