EMAIL THIS PAGE TO A FRIEND

AVPR2

arginine vasopressin receptor 2

Synonyms: ADHR DI1 DIR DIR3 NDI V2R
UniProtKB ID: P30518, C5HF20, O43192, Q3MJD3, Q9UCV9
Gene ID:
Human(554) Summary: This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008]
Mouse(12000) arginine vasopressin receptor 2
Rat(25108) arginine vasopressin receptor 2
sheep(100528011) arginine vasopressin receptor 2
Domestic Rabbit(100328747) arginine vasopressin receptor 2
domestic guinea pig(100712605) arginine vasopressin receptor 2
naked mole-rat(101725573) arginine vasopressin receptor 2
chicken(427860) arginine vasopressin receptor 2
dog(403804) arginine vasopressin receptor 2
cow(281642) arginine vasopressin receptor 2
domestic cat(101082135) arginine vasopressin receptor 2
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
V1005 [deamino-Cys1, D-Arg8]-Vasopressin acetate salt hydrate ≥97% (HPLC) human, mouse, rat pricing
V2013 [deamino-Cys1, Val4, D-Arg8]-Vasopressin ≥95% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000054 Rosetta Predictions human pricing
NM_019136 Rosetta Predictions rat pricing
NM_019404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029730 predicted 641
2 SASI_Hs01_00029732 predicted 1080
3 SASI_Hs01_00029733 predicted 501
4 SASI_Hs01_00029734 predicted 785
5 SASI_Hs02_00301761 predicted 530
6 SASI_Hs02_00301762 predicted 1021
7 SASI_Hs01_00029735 predicted 954
8 SASI_Hs01_00029737 predicted 779
9 SASI_Hs02_00301763 predicted 866
10 SASI_Hs02_00301764 predicted 968
11 SASI_Hs01_00029731 predicted 1044
12 SASI_Hs01_00029736 predicted 243
13 SASI_Hs01_00029738 predicted 1183
14 SASI_Hs01_00029739 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041894 predicted 355
2 SASI_Rn02_00261885 predicted 806
3 SASI_Rn01_00041895 predicted 853
4 SASI_Rn01_00041896 predicted 656
5 SASI_Rn01_00041898 predicted 540
6 SASI_Rn01_00041899 predicted 210
7 SASI_Rn01_00041900 predicted 619
8 SASI_Rn01_00041901 predicted 525
9 SASI_Rn01_00041902 predicted 245
10 SASI_Rn02_00261886 predicted 815
11 SASI_Rn01_00041897 predicted 606
12 SASI_Rn01_00041903 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324326 predicted 1289
2 SASI_Mm01_00131939 predicted 1408
3 SASI_Mm01_00131941 predicted 1424
4 SASI_Mm01_00131942 predicted 811
5 SASI_Mm01_00131943 predicted 666
6 SASI_Mm01_00131944 predicted 238
7 SASI_Mm01_00131945 predicted 955
8 SASI_Mm01_00131946 predicted 1080
9 SASI_Mm01_00131947 predicted 1570
10 SASI_Mm01_00131948 predicted 376
11 SASI_Mm01_00131940 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000054
AVPR2 MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-1054s1c1
Sequence:CCGGGCTAGTGATTGTGGTCGTCTACTCGAGTAGACGACCACAATCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-361s1c1
Sequence:CCGGGCTGCTCTCCATAGTCTTTGTCTCGAGACAAAGACTATGGAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-1150s1c1
Sequence:CCGGGCCCTTTGTGCTACTCATGTTCTCGAGAACATGAGTAGCACAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-842s1c1
Sequence:CCGGCGCACCTATGTCACCTGGATTCTCGAGAATCCAGGTGACATAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000054.2-1582s1c1
Sequence:CCGGCAGCTCACTGAGCTGGGTGTACTCGAGTACACCCAGCTCAGTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-892s21c1
Sequence:CCGGTAGTGATTGTGGTCGTCTATGCTCGAGCATAGACGACCACAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-748s21c1
Sequence:CCGGTGCTCATCTTCCGGGAGATTCCTCGAGGAATCTCCCGGAAGATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-196s21c1
Sequence:CCGGCGCTGCTCTCCATAGTCTTTGCTCGAGCAAAGACTATGGAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-1035s21c1
Sequence:CCGGCCCTGGATCTATGCATCTTTCCTCGAGGAAAGATGCATAGATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000054
AVPR2 MISSION shRNA shRNA Plasmid DNA
arginine vasopressin receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-1054s1c1
Sequence:CCGGGCTAGTGATTGTGGTCGTCTACTCGAGTAGACGACCACAATCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-361s1c1
Sequence:CCGGGCTGCTCTCCATAGTCTTTGTCTCGAGACAAAGACTATGGAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-1150s1c1
Sequence:CCGGGCCCTTTGTGCTACTCATGTTCTCGAGAACATGAGTAGCACAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-842s1c1
Sequence:CCGGCGCACCTATGTCACCTGGATTCTCGAGAATCCAGGTGACATAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000054.2-1582s1c1
Sequence:CCGGCAGCTCACTGAGCTGGGTGTACTCGAGTACACCCAGCTCAGTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-892s21c1
Sequence:CCGGTAGTGATTGTGGTCGTCTATGCTCGAGCATAGACGACCACAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-748s21c1
Sequence:CCGGTGCTCATCTTCCGGGAGATTCCTCGAGGAATCTCCCGGAAGATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-196s21c1
Sequence:CCGGCGCTGCTCTCCATAGTCTTTGCTCGAGCAAAGACTATGGAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-1035s21c1
Sequence:CCGGCCCTGGATCTATGCATCTTTCCTCGAGGAAAGATGCATAGATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000054
AVPR2 MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-1054s1c1
Sequence:CCGGGCTAGTGATTGTGGTCGTCTACTCGAGTAGACGACCACAATCACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-361s1c1
Sequence:CCGGGCTGCTCTCCATAGTCTTTGTCTCGAGACAAAGACTATGGAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-1150s1c1
Sequence:CCGGGCCCTTTGTGCTACTCATGTTCTCGAGAACATGAGTAGCACAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000054.2-842s1c1
Sequence:CCGGCGCACCTATGTCACCTGGATTCTCGAGAATCCAGGTGACATAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000054.2-1582s1c1
Sequence:CCGGCAGCTCACTGAGCTGGGTGTACTCGAGTACACCCAGCTCAGTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-892s21c1
Sequence:CCGGTAGTGATTGTGGTCGTCTATGCTCGAGCATAGACGACCACAATCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-748s21c1
Sequence:CCGGTGCTCATCTTCCGGGAGATTCCTCGAGGAATCTCCCGGAAGATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-196s21c1
Sequence:CCGGCGCTGCTCTCCATAGTCTTTGCTCGAGCAAAGACTATGGAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000054.4-1035s21c1
Sequence:CCGGCCCTGGATCTATGCATCTTTCCTCGAGGAAAGATGCATAGATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019404
AVPR2 MISSION shRNA Bacterial Glycerol Stock
arginine vasopressin receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-818s1c1
Sequence:CCGGGTTCTTATCTTCCGGGAGATACTCGAGTATCTCCCGGAAGATAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-364s1c1
Sequence:CCGGGCACGTCTTCATCAGTCATTTCTCGAGAAATGACTGATGAAGACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-677s1c1
Sequence:CCGGGCTCAACGTGATGTGGGAAATCTCGAGATTTCCCACATCACGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-511s1c1
Sequence:CCGGGTATGCCTCTTCCTACATGATCTCGAGATCATGTAGGAAGAGGCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-263s1c1
Sequence:CCGGCTGGCCCTGCTATCTACAATTCTCGAGAATTGTAGATAGCAGGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019404
AVPR2 MISSION shRNA shRNA Plasmid DNA
arginine vasopressin receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-818s1c1
Sequence:CCGGGTTCTTATCTTCCGGGAGATACTCGAGTATCTCCCGGAAGATAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-364s1c1
Sequence:CCGGGCACGTCTTCATCAGTCATTTCTCGAGAAATGACTGATGAAGACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-677s1c1
Sequence:CCGGGCTCAACGTGATGTGGGAAATCTCGAGATTTCCCACATCACGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-511s1c1
Sequence:CCGGGTATGCCTCTTCCTACATGATCTCGAGATCATGTAGGAAGAGGCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-263s1c1
Sequence:CCGGCTGGCCCTGCTATCTACAATTCTCGAGAATTGTAGATAGCAGGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019404
AVPR2 MISSION shRNA Lentiviral Transduction Particles
arginine vasopressin receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-818s1c1
Sequence:CCGGGTTCTTATCTTCCGGGAGATACTCGAGTATCTCCCGGAAGATAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-364s1c1
Sequence:CCGGGCACGTCTTCATCAGTCATTTCTCGAGAAATGACTGATGAAGACGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-677s1c1
Sequence:CCGGGCTCAACGTGATGTGGGAAATCTCGAGATTTCCCACATCACGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-511s1c1
Sequence:CCGGGTATGCCTCTTCCTACATGATCTCGAGATCATGTAGGAAGAGGCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019404.1-263s1c1
Sequence:CCGGCTGGCCCTGCTATCTACAATTCTCGAGAATTGTAGATAGCAGGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks