EMAIL THIS PAGE TO A FRIEND

AWAT1

acyl-CoA wax alcohol acyltransferase 1

55 Gene Product Result for
Synonyms: DGA2 DGAT2L3
UniProtKB ID: Q58HT5, Q5JT21, Q6IEE4
Gene ID:
Human(158833) Summary: The protein encoded by this gene belongs to the diacylglycerol acyltransferase family. It esterifies long chain (wax) alcohols with acyl-CoA-derived fatty acids to produce wax esters. Wax esters are enriched in sebum, suggesting that this enzyme plays a central role in lipid metabolism in skin. Consistent with this observation, this protein is predominantly expressed in the sebaceous gland of the skin. [provided by RefSeq, Sep 2009]
Mouse(245533) acyl-CoA wax alcohol acyltransferase 1
Rat(679520) acyl-CoA wax alcohol acyltransferase 1
naked mole-rat(101703747) acyl-CoA wax alcohol acyltransferase 1
domestic guinea pig(100733420) acyl-CoA wax alcohol acyltransferase 1
sheep(101122414) acyl-CoA wax alcohol acyltransferase 1
domestic cat(101087643) acyl-CoA wax alcohol acyltransferase 1
cow(529893) acyl-CoA wax alcohol acyltransferase 1
dog(491938) acyl-CoA wax alcohol acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_088691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088691 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146601 MISSION® esiRNA esiRNA human AWAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013579 Rosetta Predictions human pricing
NM_001109371 Rosetta Predictions rat pricing
NM_001081136 Rosetta Predictions mouse pricing
XM_141972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053418 predicted 729
2 SASI_Hs01_00053419 predicted 438
3 SASI_Hs01_00053420 predicted 270
4 SASI_Hs01_00053421 predicted 509
5 SASI_Hs01_00053422 predicted 348
6 SASI_Hs01_00053423 predicted 196
7 SASI_Hs02_00306379 predicted 752
8 SASI_Hs01_00053424 predicted 222
9 SASI_Hs01_00053425 predicted 258
10 SASI_Hs01_00053427 predicted 678
11 SASI_Hs01_00053426 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247766 predicted 453
2 SASI_Rn02_00247767 predicted 659
3 SASI_Rn02_00247768 predicted 920
4 SASI_Rn02_00247769 predicted 1048
5 SASI_Rn02_00247770 predicted 228
6 SASI_Rn02_00247771 predicted 896
7 SASI_Rn02_00247772 predicted 1096
8 SASI_Rn02_00247773 predicted 684
9 SASI_Rn02_00247774 predicted 283
10 SASI_Rn02_00247775 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295541 predicted 1026
2 SASI_Mm02_00295542 predicted 221
3 SASI_Mm02_00295543 predicted 1058
4 SASI_Mm02_00295544 predicted 1115
5 SASI_Mm02_00295545 predicted 988
6 SASI_Mm02_00295546 predicted 266
7 SASI_Mm02_00295547 predicted 1167
8 SASI_Mm02_00295548 predicted 295
9 SASI_Mm02_00295549 predicted 786
10 SASI_Mm02_00295550 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_141972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245751 predicted 1034
2 SASI_Mm01_00245752 predicted 225
3 SASI_Mm01_00245753 predicted 1067
4 SASI_Mm01_00245754 predicted 1120
5 SASI_Mm01_00245755 predicted 985
6 SASI_Mm01_00245756 predicted 265
7 SASI_Mm01_00245757 predicted 597
8 SASI_Mm01_00245758 predicted 1170
9 SASI_Mm01_00245759 predicted 303
10 SASI_Mm01_00245760 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081136
AWAT1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA wax alcohol acyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081136.1-1219s21c1
Sequence:CCGGAGCTCCTTCCTGACCATAATACTCGAGTATTATGGTCAGGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-213s21c1
Sequence:CCGGGTGGCCGCTACCAACAGTTTACTCGAGTAAACTGTTGGTAGCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-738s21c1
Sequence:CCGGTACCTTCACGTTCGGAGAAACCTCGAGGTTTCTCCGAACGTGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-824s21c1
Sequence:CCGGGCCGGATCTTTGGTTTCTATTCTCGAGAATAGAAACCAAAGATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-315s21c1
Sequence:CCGGGAACCACATCAGGGACTATTTCTCGAGAAATAGTCCCTGATGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081136
AWAT1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA wax alcohol acyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081136.1-1219s21c1
Sequence:CCGGAGCTCCTTCCTGACCATAATACTCGAGTATTATGGTCAGGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-213s21c1
Sequence:CCGGGTGGCCGCTACCAACAGTTTACTCGAGTAAACTGTTGGTAGCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-738s21c1
Sequence:CCGGTACCTTCACGTTCGGAGAAACCTCGAGGTTTCTCCGAACGTGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-824s21c1
Sequence:CCGGGCCGGATCTTTGGTTTCTATTCTCGAGAATAGAAACCAAAGATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-315s21c1
Sequence:CCGGGAACCACATCAGGGACTATTTCTCGAGAAATAGTCCCTGATGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081136
AWAT1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA wax alcohol acyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081136.1-1219s21c1
Sequence:CCGGAGCTCCTTCCTGACCATAATACTCGAGTATTATGGTCAGGAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-213s21c1
Sequence:CCGGGTGGCCGCTACCAACAGTTTACTCGAGTAAACTGTTGGTAGCGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-738s21c1
Sequence:CCGGTACCTTCACGTTCGGAGAAACCTCGAGGTTTCTCCGAACGTGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-824s21c1
Sequence:CCGGGCCGGATCTTTGGTTTCTATTCTCGAGAATAGAAACCAAAGATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081136.1-315s21c1
Sequence:CCGGGAACCACATCAGGGACTATTTCTCGAGAAATAGTCCCTGATGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088691
AWAT1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA wax alcohol acyltransferase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-104s1c1
Sequence:CCGGCCGCTACCAGTGCTTTACTTTCTCGAGAAAGTAAAGCACTGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-820s1c1
Sequence:CCGGGTGGACAAATACCATGCACTTCTCGAGAAGTGCATGGTATTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-345s1c1
Sequence:CCGGGCTGTCCTGGTTCTTCAAGATCTCGAGATCTTGAAGAACCAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-669s1c1
Sequence:CCGGCCGCCGTATCTTTGGTTTCTACTCGAGTAGAAACCAAAGATACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-868s1c1
Sequence:CCGGGACCAGCATAAGACCCACTATCTCGAGATAGTGGGTCTTATGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088691
AWAT1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA wax alcohol acyltransferase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-104s1c1
Sequence:CCGGCCGCTACCAGTGCTTTACTTTCTCGAGAAAGTAAAGCACTGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-820s1c1
Sequence:CCGGGTGGACAAATACCATGCACTTCTCGAGAAGTGCATGGTATTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-345s1c1
Sequence:CCGGGCTGTCCTGGTTCTTCAAGATCTCGAGATCTTGAAGAACCAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-669s1c1
Sequence:CCGGCCGCCGTATCTTTGGTTTCTACTCGAGTAGAAACCAAAGATACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-868s1c1
Sequence:CCGGGACCAGCATAAGACCCACTATCTCGAGATAGTGGGTCTTATGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088691
AWAT1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA wax alcohol acyltransferase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-104s1c1
Sequence:CCGGCCGCTACCAGTGCTTTACTTTCTCGAGAAAGTAAAGCACTGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-820s1c1
Sequence:CCGGGTGGACAAATACCATGCACTTCTCGAGAAGTGCATGGTATTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-345s1c1
Sequence:CCGGGCTGTCCTGGTTCTTCAAGATCTCGAGATCTTGAAGAACCAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-669s1c1
Sequence:CCGGCCGCCGTATCTTTGGTTTCTACTCGAGTAGAAACCAAAGATACGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088691.3-868s1c1
Sequence:CCGGGACCAGCATAAGACCCACTATCTCGAGATAGTGGGTCTTATGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks