EMAIL THIS PAGE TO A FRIEND

AWAT2

acyl-CoA wax alcohol acyltransferase 2

Synonyms: ARAT DC4 DGAT2L4 MFAT WS
UniProtKB ID: Q6E213, Q6IEE3, Q6P437
Gene ID:
Human(158835) Summary: This gene encodes an enzyme belonging to the diacylglycerol acyltransferase family. This enzyme produces wax esters by the esterification of long chain (or wax) alcohols with acyl-CoA-derived fatty acids. It functions in lipid metabolism in the skin, mostly in undifferentiated peripheral sebocytes. This enzyme may also have acyl-CoA:retinol acyltransferase activities, where it catalyzes the synthesis of diacylglycerols and retinyl esters. [provided by RefSeq, May 2010]
Mouse(245532) acyl-CoA wax alcohol acyltransferase 2
Rat(302425) acyl-CoA wax alcohol acyltransferase 2
dog(491936) acyl-CoA wax alcohol acyltransferase 2
domestic cat(101086879) acyl-CoA wax alcohol acyltransferase 2
cow(521298) acyl-CoA wax alcohol acyltransferase 2
sheep(101121241) acyl-CoA wax alcohol acyltransferase 2
domestic guinea pig(100734162) acyl-CoA wax alcohol acyltransferase 2
naked mole-rat(101701856) acyl-CoA wax alcohol acyltransferase 2
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_088683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035961 MISSION® esiRNA esiRNA targeting mouse Dgat2l4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002254 Rosetta Predictions human pricing
XM_001069359 Rosetta Predictions rat pricing
XM_228583 Rosetta Predictions rat pricing
NM_177746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027426 predicted 898
2 SASI_Hs02_00304144 predicted 586
3 SASI_Hs01_00027427 predicted 687
4 SASI_Hs01_00027428 predicted 919
5 SASI_Hs01_00027429 predicted 516
6 SASI_Hs01_00027431 predicted 449
7 SASI_Hs02_00304145 predicted 821
8 SASI_Hs01_00027432 predicted 761
9 SASI_Hs01_00027433 predicted 544
10 SASI_Hs01_00027434 predicted 208
11 SASI_Hs01_00027430 predicted 509
12 SASI_Hs01_00027435 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327756 predicted 713
2 SASI_Rn02_00327757 predicted 524
3 SASI_Rn02_00327758 predicted 584
4 SASI_Rn02_00327759 predicted 280
5 SASI_Rn02_00327760 predicted 679
6 SASI_Rn02_00327761 predicted 576
7 SASI_Rn02_00327762 predicted 387
8 SASI_Rn02_00327763 predicted 321
9 SASI_Rn02_00327764 predicted 447
10 SASI_Rn02_00327765 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385260 predicted 818
2 SASI_Rn02_00385261 predicted 635
3 SASI_Rn02_00385262 predicted 194
4 SASI_Rn02_00385263 predicted 694
5 SASI_Rn02_00385264 predicted 385
6 SASI_Rn02_00385265 predicted 797
7 SASI_Rn02_00385266 predicted 688
8 SASI_Rn02_00385267 predicted 496
9 SASI_Rn02_00385268 predicted 433
10 SASI_Rn02_00385269 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152264 predicted 928
2 SASI_Mm01_00152265 predicted 977
3 SASI_Mm01_00152266 predicted 925
4 SASI_Mm01_00152267 predicted 276
5 SASI_Mm01_00152268 predicted 918
6 SASI_Mm01_00152269 predicted 306
7 SASI_Mm01_00152270 predicted 421
8 SASI_Mm01_00152271 predicted 933
9 SASI_Mm01_00152272 predicted 296
10 SASI_Mm01_00152273 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088683
AWAT2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA wax alcohol acyltransferase 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000036179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-901s1c1
Sequence:CCGGGCTAAATATCACACACTCTATCTCGAGATAGAGTGTGTGATATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-752s1c1
Sequence:CCGGGCATGGTACACATCTACCCTTCTCGAGAAGGGTAGATGTGTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-139s1c1
Sequence:CCGGCCTGTCACTGTGCTTATTCTTCTCGAGAAGAATAAGCACAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-862s1c1
Sequence:CCGGCCAATGCCCAAGATTGAGAATCTCGAGATTCTCAATCTTGGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088683
AWAT2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA wax alcohol acyltransferase 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000036179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-901s1c1
Sequence:CCGGGCTAAATATCACACACTCTATCTCGAGATAGAGTGTGTGATATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-752s1c1
Sequence:CCGGGCATGGTACACATCTACCCTTCTCGAGAAGGGTAGATGTGTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-139s1c1
Sequence:CCGGCCTGTCACTGTGCTTATTCTTCTCGAGAAGAATAAGCACAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-862s1c1
Sequence:CCGGCCAATGCCCAAGATTGAGAATCTCGAGATTCTCAATCTTGGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088683
AWAT2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA wax alcohol acyltransferase 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000036179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-901s1c1
Sequence:CCGGGCTAAATATCACACACTCTATCTCGAGATAGAGTGTGTGATATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-752s1c1
Sequence:CCGGGCATGGTACACATCTACCCTTCTCGAGAAGGGTAGATGTGTACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-139s1c1
Sequence:CCGGCCTGTCACTGTGCTTATTCTTCTCGAGAAGAATAAGCACAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088683.2-862s1c1
Sequence:CCGGCCAATGCCCAAGATTGAGAATCTCGAGATTCTCAATCTTGGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177746
AWAT2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA wax alcohol acyltransferase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177746.2-1252s1c1
Sequence:CCGGCAGCCAGTAACCACTGTTGTTCTCGAGAACAACAGTGGTTACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177746.2-1285s1c1
Sequence:CCGGCCATTGCCCAAGATTGAGAATCTCGAGATTCTCAATCTTGGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-930s21c1
Sequence:CCGGCAAATACCACACACTCTATATCTCGAGATATAGAGTGTGTGGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-254s21c1
Sequence:CCGGGGCGTCTGTGGAAACACTATACTCGAGTATAGTGTTTCCACAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177746.3-1284s1c1
Sequence:CCGGGAAACCTGTAGGTGGAATAAACTCGAGTTTATTCCACCTACAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-420s21c1
Sequence:CCGGTCCTGGTATCACTCCTTATATCTCGAGATATAAGGAGTGATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177746.3-1284s21c1
Sequence:CCGGGAAACCTGTAGGTGGAATAAACTCGAGTTTATTCCACCTACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-110s21c1
Sequence:CCGGTAGTCACCACTGTGATCATTGCTCGAGCAATGATCACAGTGGTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177746
AWAT2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA wax alcohol acyltransferase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177746.2-1252s1c1
Sequence:CCGGCAGCCAGTAACCACTGTTGTTCTCGAGAACAACAGTGGTTACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177746.2-1285s1c1
Sequence:CCGGCCATTGCCCAAGATTGAGAATCTCGAGATTCTCAATCTTGGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-930s21c1
Sequence:CCGGCAAATACCACACACTCTATATCTCGAGATATAGAGTGTGTGGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-254s21c1
Sequence:CCGGGGCGTCTGTGGAAACACTATACTCGAGTATAGTGTTTCCACAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177746.3-1284s1c1
Sequence:CCGGGAAACCTGTAGGTGGAATAAACTCGAGTTTATTCCACCTACAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-420s21c1
Sequence:CCGGTCCTGGTATCACTCCTTATATCTCGAGATATAAGGAGTGATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177746.3-1284s21c1
Sequence:CCGGGAAACCTGTAGGTGGAATAAACTCGAGTTTATTCCACCTACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-110s21c1
Sequence:CCGGTAGTCACCACTGTGATCATTGCTCGAGCAATGATCACAGTGGTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177746
AWAT2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA wax alcohol acyltransferase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177746.2-1252s1c1
Sequence:CCGGCAGCCAGTAACCACTGTTGTTCTCGAGAACAACAGTGGTTACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177746.2-1285s1c1
Sequence:CCGGCCATTGCCCAAGATTGAGAATCTCGAGATTCTCAATCTTGGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-930s21c1
Sequence:CCGGCAAATACCACACACTCTATATCTCGAGATATAGAGTGTGTGGTATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-254s21c1
Sequence:CCGGGGCGTCTGTGGAAACACTATACTCGAGTATAGTGTTTCCACAGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177746.3-1284s1c1
Sequence:CCGGGAAACCTGTAGGTGGAATAAACTCGAGTTTATTCCACCTACAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-420s21c1
Sequence:CCGGTCCTGGTATCACTCCTTATATCTCGAGATATAAGGAGTGATACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177746.3-1284s21c1
Sequence:CCGGGAAACCTGTAGGTGGAATAAACTCGAGTTTATTCCACCTACAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177746.3-110s21c1
Sequence:CCGGTAGTCACCACTGTGATCATTGCTCGAGCAATGATCACAGTGGTGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks