EMAIL THIS PAGE TO A FRIEND

AXDND1

axonemal dynein light chain domain containing 1

45 Gene Product Result for
Synonyms: C1orf125 RP11-215I23.2
UniProtKB ID: Q5T1B0, Q6AWB2, Q96LJ3, Q96M01
Gene ID:
Mouse(77352) axonemal dynein light chain domain containing 1
naked mole-rat(101724917) axonemal dynein light chain domain containing 1
domestic guinea pig(100716474) axonemal dynein light chain domain containing 1
sheep(101118888) axonemal dynein light chain domain containing 1
Zebrafish(557839) axonemal dynein light chain domain containing 1
chicken(100858527) axonemal dynein light chain domain containing 1
cow(613754) axonemal dynein light chain domain containing 1
domestic cat(101084675) axonemal dynein light chain domain containing 1
dog(480051) axonemal dynein light chain domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144696 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144696 Rosetta Predictions human pricing
NM_182766 Rosetta Predictions human pricing
NM_001033180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069422 predicted 1991
2 SASI_Hs01_00069423 predicted 1420
3 SASI_Hs01_00069425 predicted 962
4 SASI_Hs01_00069426 predicted 2178
5 SASI_Hs01_00069427 predicted 1996
6 SASI_Hs01_00069428 predicted 861
7 SASI_Hs01_00069429 predicted 1058
8 SASI_Hs01_00069430 predicted 1935
9 SASI_Hs01_00069431 predicted 590
10 SASI_Hs02_00364619 predicted 1551
11 SASI_Hs01_00069424 predicted 1786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050144 predicted 1986
2 SASI_Hs01_00050145 predicted 1423
3 SASI_Hs01_00050147 predicted 963
4 SASI_Hs01_00050148 predicted 2170
5 SASI_Hs01_00050149 predicted 1998
6 SASI_Hs01_00050150 predicted 859
7 SASI_Hs01_00050151 predicted 1058
8 SASI_Hs01_00050153 predicted 1937
9 SASI_Hs02_00370934 predicted 585
10 SASI_Hs02_00370935 predicted 1547
11 SASI_Hs01_00050146 predicted 1785
12 SASI_Hs01_00050152 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181929 predicted 423
2 SASI_Mm01_00181930 predicted 1464
3 SASI_Mm01_00181931 predicted 1076
4 SASI_Mm01_00181932 predicted 1347
5 SASI_Mm01_00181933 predicted 510
6 SASI_Mm01_00181934 predicted 1086
7 SASI_Mm01_00181935 predicted 428
8 SASI_Mm01_00181936 predicted 1274
9 SASI_Mm02_00288291 predicted 996
10 SASI_Mm01_00181937 predicted 720
11 SASI_Mm01_00181938 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144696
AXDND1 MISSION shRNA Bacterial Glycerol Stock
axonemal dynein light chain domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144696.4-3243s21c1
Sequence:CCGGACTTCATCATACCCTTATAAACTCGAGTTTATAAGGGTATGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144696.4-2047s21c1
Sequence:CCGGGATATTGGGCTTGGGATATTTCTCGAGAAATATCCCAAGCCCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2067s1c1
Sequence:CCGGGTACCAATACTCCAGCTATTTCTCGAGAAATAGCTGGAGTATTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2272s1c1
Sequence:CCGGGAAGAAATAGAGCGGCTACTTCTCGAGAAGTAGCCGCTCTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2402s1c1
Sequence:CCGGGAGCAGAAGAACAACCTTCAACTCGAGTTGAAGGTTGTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2173s1c1
Sequence:CCGGGAGGTGGATAAGTTGAAGAAACTCGAGTTTCTTCAACTTATCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-1263s1c1
Sequence:CCGGGCTTATCAAATGGCAGGAGTTCTCGAGAACTCCTGCCATTTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144696
AXDND1 MISSION shRNA shRNA Plasmid DNA
axonemal dynein light chain domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144696.4-3243s21c1
Sequence:CCGGACTTCATCATACCCTTATAAACTCGAGTTTATAAGGGTATGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144696.4-2047s21c1
Sequence:CCGGGATATTGGGCTTGGGATATTTCTCGAGAAATATCCCAAGCCCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2067s1c1
Sequence:CCGGGTACCAATACTCCAGCTATTTCTCGAGAAATAGCTGGAGTATTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2272s1c1
Sequence:CCGGGAAGAAATAGAGCGGCTACTTCTCGAGAAGTAGCCGCTCTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2402s1c1
Sequence:CCGGGAGCAGAAGAACAACCTTCAACTCGAGTTGAAGGTTGTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2173s1c1
Sequence:CCGGGAGGTGGATAAGTTGAAGAAACTCGAGTTTCTTCAACTTATCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-1263s1c1
Sequence:CCGGGCTTATCAAATGGCAGGAGTTCTCGAGAACTCCTGCCATTTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144696
AXDND1 MISSION shRNA Lentiviral Transduction Particles
axonemal dynein light chain domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144696.4-3243s21c1
Sequence:CCGGACTTCATCATACCCTTATAAACTCGAGTTTATAAGGGTATGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144696.4-2047s21c1
Sequence:CCGGGATATTGGGCTTGGGATATTTCTCGAGAAATATCCCAAGCCCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2067s1c1
Sequence:CCGGGTACCAATACTCCAGCTATTTCTCGAGAAATAGCTGGAGTATTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2272s1c1
Sequence:CCGGGAAGAAATAGAGCGGCTACTTCTCGAGAAGTAGCCGCTCTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2402s1c1
Sequence:CCGGGAGCAGAAGAACAACCTTCAACTCGAGTTGAAGGTTGTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-2173s1c1
Sequence:CCGGGAGGTGGATAAGTTGAAGAAACTCGAGTTTCTTCAACTTATCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144696.2-1263s1c1
Sequence:CCGGGCTTATCAAATGGCAGGAGTTCTCGAGAACTCCTGCCATTTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033180
AXDND1 MISSION shRNA Bacterial Glycerol Stock
axonemal dynein light chain domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-675s21c1
Sequence:CCGGTAGAAGACTACCACGACTTATCTCGAGATAAGTCGTGGTAGTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1139s21c1
Sequence:CCGGGGGATACTGAGTCGCCATAAACTCGAGTTTATGGCGACTCAGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1409s21c1
Sequence:CCGGGAAGCGCTGTTGAACATTATTCTCGAGAATAATGTTCAACAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1188s21c1
Sequence:CCGGACGAGTACATGGAAGATATTGCTCGAGCAATATCTTCCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033180.2-1874s21c1
Sequence:CCGGCTAGTAAGCCTATCCCTTAAACTCGAGTTTAAGGGATAGGCTTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033180
AXDND1 MISSION shRNA shRNA Plasmid DNA
axonemal dynein light chain domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-675s21c1
Sequence:CCGGTAGAAGACTACCACGACTTATCTCGAGATAAGTCGTGGTAGTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1139s21c1
Sequence:CCGGGGGATACTGAGTCGCCATAAACTCGAGTTTATGGCGACTCAGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1409s21c1
Sequence:CCGGGAAGCGCTGTTGAACATTATTCTCGAGAATAATGTTCAACAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1188s21c1
Sequence:CCGGACGAGTACATGGAAGATATTGCTCGAGCAATATCTTCCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033180.2-1874s21c1
Sequence:CCGGCTAGTAAGCCTATCCCTTAAACTCGAGTTTAAGGGATAGGCTTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033180
AXDND1 MISSION shRNA Lentiviral Transduction Particles
axonemal dynein light chain domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-675s21c1
Sequence:CCGGTAGAAGACTACCACGACTTATCTCGAGATAAGTCGTGGTAGTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1139s21c1
Sequence:CCGGGGGATACTGAGTCGCCATAAACTCGAGTTTATGGCGACTCAGTATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1409s21c1
Sequence:CCGGGAAGCGCTGTTGAACATTATTCTCGAGAATAATGTTCAACAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033180.2-1188s21c1
Sequence:CCGGACGAGTACATGGAAGATATTGCTCGAGCAATATCTTCCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033180.2-1874s21c1
Sequence:CCGGCTAGTAAGCCTATCCCTTAAACTCGAGTTTAAGGGATAGGCTTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks