EMAIL THIS PAGE TO A FRIEND

AXIN1

axin 1

Synonyms: AXIN PPP1R49
UniProtKB ID: O15169, Q4TT26, Q4TT27, Q86YA7, Q8WVW6, Q96S28
Gene ID:
Human(8312) Summary: This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2010]
Mouse(12005) axin 1
Rat(79257) axin 1
cow(504357) axin 1
dog(490099) axin 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003502 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003502 siRNAs that have been validated in the lab human pricing
NM_181050 Rosetta Predictions human pricing
NM_024405 Rosetta Predictions rat pricing
NM_009733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003502 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120254 validated 778
1 SASI_Hs01_00120255 validated 873
2 SASI_Hs01_00120252 predicted 463
3 SASI_Hs01_00120257 predicted 767
4 SASI_Hs01_00120258 predicted 604
5 SASI_Hs01_00120260 predicted 608
6 SASI_Hs01_00120261 predicted 484
7 SASI_Hs02_00335782 predicted 1207
8 SASI_Hs02_00335783 predicted 888
9 SASI_Hs02_00335784 predicted 874
10 SASI_Hs01_00120253 predicted 481
11 SASI_Hs01_00120256 predicted 319
12 SASI_Hs01_00120259 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241598 predicted 464
2 SASI_Hs01_00241600 predicted 771
3 SASI_Hs01_00241601 predicted 878
4 SASI_Hs01_00241603 predicted 768
5 SASI_Hs01_00241604 predicted 598
6 SASI_Hs01_00241606 predicted 610
7 SASI_Hs01_00241607 predicted 481
8 SASI_Hs02_00369925 predicted 1203
9 SASI_Hs02_00369926 predicted 891
10 SASI_Hs02_00369927 predicted 880
11 SASI_Hs01_00241599 predicted 482
12 SASI_Hs01_00241602 predicted 316
13 SASI_Hs01_00241605 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095167 predicted 734
2 SASI_Rn01_00095168 predicted 1535
3 SASI_Rn02_00264010 predicted 299
4 SASI_Rn01_00095169 predicted 1245
5 SASI_Rn01_00095170 predicted 807
6 SASI_Rn01_00095171 predicted 916
7 SASI_Rn01_00095172 predicted 2576
8 SASI_Rn01_00095173 predicted 1316
9 SASI_Rn01_00095174 predicted 2461
10 SASI_Rn01_00095176 predicted 402
11 SASI_Rn01_00095175 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099108 predicted 2207
2 SASI_Mm01_00099109 predicted 2102
3 SASI_Mm01_00099110 predicted 1419
4 SASI_Mm01_00099111 predicted 2261
5 SASI_Mm01_00099112 predicted 1086
6 SASI_Mm01_00099113 predicted 2196
7 SASI_Mm01_00099114 predicted 914
8 SASI_Mm01_00099115 predicted 2003
9 SASI_Mm01_00099116 predicted 965
10 SASI_Mm01_00099117 predicted 3077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009733
AXIN1 MISSION shRNA Bacterial Glycerol Stock
axin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009733.1-3461s1c1
Sequence:CCGGCCTTCAACATAGCTGTCTCTTCTCGAGAAGAGACAGCTATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-2264s1c1
Sequence:CCGGCCAGAAGATCATGCAGTGGATCTCGAGATCCACTGCATGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-873s1c1
Sequence:CCGGCCAGCCACTAAGAGCTTCATACTCGAGTATGAAGCTCTTAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-1104s1c1
Sequence:CCGGCCCACTTTGAATGAGGATGAACTCGAGTTCATCCTCATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-2737s1c1
Sequence:CCGGGCATTGTTGTGGGCTACTATTCTCGAGAATAGTAGCCCACAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009733
AXIN1 MISSION shRNA shRNA Plasmid DNA
axin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009733.1-3461s1c1
Sequence:CCGGCCTTCAACATAGCTGTCTCTTCTCGAGAAGAGACAGCTATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-2264s1c1
Sequence:CCGGCCAGAAGATCATGCAGTGGATCTCGAGATCCACTGCATGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-873s1c1
Sequence:CCGGCCAGCCACTAAGAGCTTCATACTCGAGTATGAAGCTCTTAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-1104s1c1
Sequence:CCGGCCCACTTTGAATGAGGATGAACTCGAGTTCATCCTCATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-2737s1c1
Sequence:CCGGGCATTGTTGTGGGCTACTATTCTCGAGAATAGTAGCCCACAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009733
AXIN1 MISSION shRNA Lentiviral Transduction Particles
axin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009733.1-3461s1c1
Sequence:CCGGCCTTCAACATAGCTGTCTCTTCTCGAGAAGAGACAGCTATGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-2264s1c1
Sequence:CCGGCCAGAAGATCATGCAGTGGATCTCGAGATCCACTGCATGATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-873s1c1
Sequence:CCGGCCAGCCACTAAGAGCTTCATACTCGAGTATGAAGCTCTTAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-1104s1c1
Sequence:CCGGCCCACTTTGAATGAGGATGAACTCGAGTTCATCCTCATTCAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009733.1-2737s1c1
Sequence:CCGGGCATTGTTGTGGGCTACTATTCTCGAGAATAGTAGCCCACAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003502
VALIDATED
AXIN1 MISSION shRNA Bacterial Glycerol Stock
axin 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003502.2-2050s1c1
Sequence:CCGGGATGCGGAGAAGAACCAGAAACTCGAGTTTCTGGTTCTTCTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-612s1c1
Sequence:CCGGCCGAAAGTACATTCTTGATAACTCGAGTTATCAAGAATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-2728s1c1
Sequence:CCGGGAGGAGAAGATCATCGGCAAACTCGAGTTTGCCGATGATCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-1043s1c1
Sequence:CCGGGCAGAGAGTTCAGGTATGGATCTCGAGATCCATACCTGAACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-3309s1c1
Sequence:CCGGCCCGTGTAAATATGTACATTTCTCGAGAAATGTACATATTTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003502.2-3098s21c1
Sequence:CCGGCTACTTTCCCTCTGGGATTTGCTCGAGCAAATCCCAGAGGGAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-2728s21c1
Sequence:CCGGGAGGAGAAGATCATCGGCAAACTCGAGTTTGCCGATGATCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-2050s21c1
Sequence:CCGGGATGCGGAGAAGAACCAGAAACTCGAGTTTCTGGTTCTTCTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-1043s21c1
Sequence:CCGGGCAGAGAGTTCAGGTATGGATCTCGAGATCCATACCTGAACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-612s21c1
Sequence:CCGGCCGAAAGTACATTCTTGATAACTCGAGTTATCAAGAATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003502.2-2974s21c1
Sequence:CCGGGGACCACTCCTCATAGCAATACTCGAGTATTGCTATGAGGAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003502
VALIDATED
AXIN1 MISSION shRNA shRNA Plasmid DNA
axin 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003502.2-2050s1c1
Sequence:CCGGGATGCGGAGAAGAACCAGAAACTCGAGTTTCTGGTTCTTCTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-612s1c1
Sequence:CCGGCCGAAAGTACATTCTTGATAACTCGAGTTATCAAGAATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-2728s1c1
Sequence:CCGGGAGGAGAAGATCATCGGCAAACTCGAGTTTGCCGATGATCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-1043s1c1
Sequence:CCGGGCAGAGAGTTCAGGTATGGATCTCGAGATCCATACCTGAACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-3309s1c1
Sequence:CCGGCCCGTGTAAATATGTACATTTCTCGAGAAATGTACATATTTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003502.2-3098s21c1
Sequence:CCGGCTACTTTCCCTCTGGGATTTGCTCGAGCAAATCCCAGAGGGAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-2728s21c1
Sequence:CCGGGAGGAGAAGATCATCGGCAAACTCGAGTTTGCCGATGATCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-2050s21c1
Sequence:CCGGGATGCGGAGAAGAACCAGAAACTCGAGTTTCTGGTTCTTCTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-1043s21c1
Sequence:CCGGGCAGAGAGTTCAGGTATGGATCTCGAGATCCATACCTGAACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-612s21c1
Sequence:CCGGCCGAAAGTACATTCTTGATAACTCGAGTTATCAAGAATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003502.2-2974s21c1
Sequence:CCGGGGACCACTCCTCATAGCAATACTCGAGTATTGCTATGAGGAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003502
VALIDATED
AXIN1 MISSION shRNA Lentiviral Transduction Particles
axin 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003502.2-2050s1c1
Sequence:CCGGGATGCGGAGAAGAACCAGAAACTCGAGTTTCTGGTTCTTCTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-612s1c1
Sequence:CCGGCCGAAAGTACATTCTTGATAACTCGAGTTATCAAGAATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-2728s1c1
Sequence:CCGGGAGGAGAAGATCATCGGCAAACTCGAGTTTGCCGATGATCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-1043s1c1
Sequence:CCGGGCAGAGAGTTCAGGTATGGATCTCGAGATCCATACCTGAACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003502.2-3309s1c1
Sequence:CCGGCCCGTGTAAATATGTACATTTCTCGAGAAATGTACATATTTACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003502.2-3098s21c1
Sequence:CCGGCTACTTTCCCTCTGGGATTTGCTCGAGCAAATCCCAGAGGGAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-2728s21c1
Sequence:CCGGGAGGAGAAGATCATCGGCAAACTCGAGTTTGCCGATGATCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-2050s21c1
Sequence:CCGGGATGCGGAGAAGAACCAGAAACTCGAGTTTCTGGTTCTTCTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-1043s21c1
Sequence:CCGGGCAGAGAGTTCAGGTATGGATCTCGAGATCCATACCTGAACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003502.2-612s21c1
Sequence:CCGGCCGAAAGTACATTCTTGATAACTCGAGTTATCAAGAATGTACTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003502.2-2974s21c1
Sequence:CCGGGGACCACTCCTCATAGCAATACTCGAGTATTGCTATGAGGAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks