EMAIL THIS PAGE TO A FRIEND

AXIN2

axin 2

94 Gene Product Result for
Synonyms: AXIL ODCRCS
UniProtKB ID: Q9Y2T1, Q3MJ88, Q9H3M6, Q9UH84
Gene ID:
Human(8313) Summary: The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
Mouse(12006) axin2
Rat(29134) axin 2
Zebrafish(58080) axin 2 (conductin, axil)
dog(490903) axin 2
cow(511619) axin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001481 MISSION® esiRNA esiRNA targeting human AXIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004655 Rosetta Predictions human pricing
NM_024355 Rosetta Predictions rat pricing
NM_015732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110148 predicted 558
2 SASI_Hs01_00110149 predicted 1149
3 SASI_Hs01_00110150 predicted 1949
4 SASI_Hs01_00110151 predicted 1214
5 SASI_Hs01_00110153 predicted 887
6 SASI_Hs01_00110154 predicted 579
7 SASI_Hs01_00110155 predicted 2040
8 SASI_Hs01_00110156 predicted 2477
9 SASI_Hs01_00110157 predicted 597
10 SASI_Hs02_00338068 predicted 1114
11 SASI_Hs01_00110152 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263913 predicted 1819
2 SASI_Rn01_00045790 predicted 2460
3 SASI_Rn01_00045791 predicted 442
4 SASI_Rn01_00045792 predicted 913
5 SASI_Rn02_00263914 predicted 2493
6 SASI_Rn01_00045793 predicted 929
7 SASI_Rn01_00045794 predicted 2392
8 SASI_Rn01_00045795 predicted 1967
9 SASI_Rn02_00263915 predicted 1079
10 SASI_Rn01_00045796 predicted 2311
11 SASI_Rn01_00045797 predicted 363
12 SASI_Rn01_00045798 predicted 1108
13 SASI_Rn01_00045799 predicted 2354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055132 predicted 911
2 SASI_Mm01_00055134 predicted 1178
3 SASI_Mm01_00055135 predicted 919
4 SASI_Mm01_00055136 predicted 2658
5 SASI_Mm01_00055137 predicted 632
6 SASI_Mm01_00055138 predicted 1199
7 SASI_Mm01_00055139 predicted 568
8 SASI_Mm01_00055140 predicted 684
9 SASI_Mm02_00323056 predicted 924
10 SASI_Mm02_00323057 predicted 1241
11 SASI_Mm01_00055133 predicted 904
12 SASI_Mm01_00055141 predicted 2567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004655
VALIDATED
AXIN2 MISSION shRNA Bacterial Glycerol Stock
axin 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1125s21c1
Sequence:CCGGCTGTTAATCCTTATCACATAGCTCGAGCTATGTGATAAGGATTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-526s21c1
Sequence:CCGGCAAGTCCTTACACTCCTTATTCTCGAGAATAAGGAGTGTAAGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.3-3175s21c1
Sequence:CCGGAGGAATCCTTACTGATATTTACTCGAGTAAATATCAGTAAGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-772s21c1
Sequence:CCGGCAAGAAGCAGCAGATTGATTCCTCGAGGAATCAATCTGCTGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.3-3123s21c1
Sequence:CCGGTAGGGATCTGAAATCCATAAACTCGAGTTTATGGATTTCAGATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.2-892s21c1
Sequence:GTACCGGCTGATATATACCTCGAATATGCTCGAGCATATTCGAGGTATATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.2-3523s21c1
Sequence:CCGGGTTGCGTCATCATCAACATTTCTCGAGAAATGTTGATGATGACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.2-1226s21c1
Sequence:CCGGTGATGCGCTGACGGATGATTCCTCGAGGAATCATCCGTCAGCGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_004655.2-766s21c1
Sequence:CCGGCTGCCACCAAGACCTACATAACTCGAGTTATGTAGGTCTTGGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004655.2-588s21c1
Sequence:CCGGGCTTACCTGTTCCGAACTTTCCTCGAGGAAAGTTCGGAACAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1176s21c1
Sequence:CCGGGCGCCAACGACAGTGAGATATCTCGAGATATCTCACTGTCGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1933s21c1
Sequence:CCGGGTATTACTGCTACTCGAAATGCTCGAGCATTTCGAGTAGCAGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004655.1-798s1c1
Sequence:CCGGGCCGACTTCAAGTGCAAACTTCTCGAGAAGTTTGCACTTGAAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004655.1-325s1c1
Sequence:CCGGCCAAGTCCTTACACTCCTTATCTCGAGATAAGGAGTGTAAGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004655.1-2574s1c1
Sequence:CCGGCCGATGTATGAAGGCCGGATTCTCGAGAATCCGGCCTTCATACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004655.1-2371s1c1
Sequence:CCGGCCAGTGAGTTGGTTGTCACTTCTCGAGAAGTGACAACCAACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004655
VALIDATED
AXIN2 MISSION shRNA shRNA Plasmid DNA
axin 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1125s21c1
Sequence:CCGGCTGTTAATCCTTATCACATAGCTCGAGCTATGTGATAAGGATTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-526s21c1
Sequence:CCGGCAAGTCCTTACACTCCTTATTCTCGAGAATAAGGAGTGTAAGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.3-3175s21c1
Sequence:CCGGAGGAATCCTTACTGATATTTACTCGAGTAAATATCAGTAAGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-772s21c1
Sequence:CCGGCAAGAAGCAGCAGATTGATTCCTCGAGGAATCAATCTGCTGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.3-3123s21c1
Sequence:CCGGTAGGGATCTGAAATCCATAAACTCGAGTTTATGGATTTCAGATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.2-892s21c1
Sequence:GTACCGGCTGATATATACCTCGAATATGCTCGAGCATATTCGAGGTATATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.2-3523s21c1
Sequence:CCGGGTTGCGTCATCATCAACATTTCTCGAGAAATGTTGATGATGACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.2-1226s21c1
Sequence:CCGGTGATGCGCTGACGGATGATTCCTCGAGGAATCATCCGTCAGCGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_004655.2-766s21c1
Sequence:CCGGCTGCCACCAAGACCTACATAACTCGAGTTATGTAGGTCTTGGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004655.2-588s21c1
Sequence:CCGGGCTTACCTGTTCCGAACTTTCCTCGAGGAAAGTTCGGAACAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1176s21c1
Sequence:CCGGGCGCCAACGACAGTGAGATATCTCGAGATATCTCACTGTCGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1933s21c1
Sequence:CCGGGTATTACTGCTACTCGAAATGCTCGAGCATTTCGAGTAGCAGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004655.1-798s1c1
Sequence:CCGGGCCGACTTCAAGTGCAAACTTCTCGAGAAGTTTGCACTTGAAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004655.1-325s1c1
Sequence:CCGGCCAAGTCCTTACACTCCTTATCTCGAGATAAGGAGTGTAAGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004655.1-2574s1c1
Sequence:CCGGCCGATGTATGAAGGCCGGATTCTCGAGAATCCGGCCTTCATACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004655.1-2371s1c1
Sequence:CCGGCCAGTGAGTTGGTTGTCACTTCTCGAGAAGTGACAACCAACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004655
VALIDATED
AXIN2 MISSION shRNA Lentiviral Transduction Particles
axin 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1125s21c1
Sequence:CCGGCTGTTAATCCTTATCACATAGCTCGAGCTATGTGATAAGGATTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-526s21c1
Sequence:CCGGCAAGTCCTTACACTCCTTATTCTCGAGAATAAGGAGTGTAAGGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.3-3175s21c1
Sequence:CCGGAGGAATCCTTACTGATATTTACTCGAGTAAATATCAGTAAGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-772s21c1
Sequence:CCGGCAAGAAGCAGCAGATTGATTCCTCGAGGAATCAATCTGCTGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.3-3123s21c1
Sequence:CCGGTAGGGATCTGAAATCCATAAACTCGAGTTTATGGATTTCAGATCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.2-892s21c1
Sequence:GTACCGGCTGATATATACCTCGAATATGCTCGAGCATATTCGAGGTATATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004655.2-3523s21c1
Sequence:CCGGGTTGCGTCATCATCAACATTTCTCGAGAAATGTTGATGATGACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.2-1226s21c1
Sequence:CCGGTGATGCGCTGACGGATGATTCCTCGAGGAATCATCCGTCAGCGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_004655.2-766s21c1
Sequence:CCGGCTGCCACCAAGACCTACATAACTCGAGTTATGTAGGTCTTGGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004655.2-588s21c1
Sequence:CCGGGCTTACCTGTTCCGAACTTTCCTCGAGGAAAGTTCGGAACAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1176s21c1
Sequence:CCGGGCGCCAACGACAGTGAGATATCTCGAGATATCTCACTGTCGTTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004655.3-1933s21c1
Sequence:CCGGGTATTACTGCTACTCGAAATGCTCGAGCATTTCGAGTAGCAGTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004655.1-798s1c1
Sequence:CCGGGCCGACTTCAAGTGCAAACTTCTCGAGAAGTTTGCACTTGAAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004655.1-325s1c1
Sequence:CCGGCCAAGTCCTTACACTCCTTATCTCGAGATAAGGAGTGTAAGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004655.1-2574s1c1
Sequence:CCGGCCGATGTATGAAGGCCGGATTCTCGAGAATCCGGCCTTCATACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004655.1-2371s1c1
Sequence:CCGGCCAGTGAGTTGGTTGTCACTTCTCGAGAAGTGACAACCAACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015732
VALIDATED
AXIN2 MISSION shRNA Bacterial Glycerol Stock
axin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-575s21c1
Sequence:CCGGACCAGGTGGACCAAGTCTTTACTCGAGTAAAGACTTGGTCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-735s21c1
Sequence:CCGGGAGTGGCCAAAGCAATCTATACTCGAGTATAGATTGCTTTGGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-2733s21c1
Sequence:CCGGAGGGAAATTACAGGTATTATTCTCGAGAATAATACCTGTAATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-623s21c1
Sequence:CCGGGCATACCTCTTCCGGACTTTCCTCGAGGAAAGTCCGGAAGAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015732.4-2956s21c1
Sequence:CCGGTACGCAACAGCCACGAAATATCTCGAGATATTTCGTGGCTGTTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015732.3-3843s1c1
Sequence:CCGGCGCTCGGGTTTGTGTTAAGTTCTCGAGAACTTAACACAAACCCGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-729s1c1
Sequence:CCGGGCAATCTATAAGAGGTACATTCTCGAGAATGTACCTCTTATAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-1621s1c1
Sequence:CCGGGCTATGAAGAGGACCCACAAACTCGAGTTTGTGGGTCCTCTTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015732.3-2610s1c1
Sequence:CCGGGAGCTGGTTGTCACCTACTTTCTCGAGAAAGTAGGTGACAACCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-1167s1c1
Sequence:CCGGCCAGTCAATCCTTATCACGTACTCGAGTACGTGATAAGGATTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015732
VALIDATED
AXIN2 MISSION shRNA shRNA Plasmid DNA
axin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-575s21c1
Sequence:CCGGACCAGGTGGACCAAGTCTTTACTCGAGTAAAGACTTGGTCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-735s21c1
Sequence:CCGGGAGTGGCCAAAGCAATCTATACTCGAGTATAGATTGCTTTGGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-2733s21c1
Sequence:CCGGAGGGAAATTACAGGTATTATTCTCGAGAATAATACCTGTAATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-623s21c1
Sequence:CCGGGCATACCTCTTCCGGACTTTCCTCGAGGAAAGTCCGGAAGAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015732.4-2956s21c1
Sequence:CCGGTACGCAACAGCCACGAAATATCTCGAGATATTTCGTGGCTGTTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015732.3-3843s1c1
Sequence:CCGGCGCTCGGGTTTGTGTTAAGTTCTCGAGAACTTAACACAAACCCGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-729s1c1
Sequence:CCGGGCAATCTATAAGAGGTACATTCTCGAGAATGTACCTCTTATAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-1621s1c1
Sequence:CCGGGCTATGAAGAGGACCCACAAACTCGAGTTTGTGGGTCCTCTTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015732.3-2610s1c1
Sequence:CCGGGAGCTGGTTGTCACCTACTTTCTCGAGAAAGTAGGTGACAACCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-1167s1c1
Sequence:CCGGCCAGTCAATCCTTATCACGTACTCGAGTACGTGATAAGGATTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015732
VALIDATED
AXIN2 MISSION shRNA Lentiviral Transduction Particles
axin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-575s21c1
Sequence:CCGGACCAGGTGGACCAAGTCTTTACTCGAGTAAAGACTTGGTCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-735s21c1
Sequence:CCGGGAGTGGCCAAAGCAATCTATACTCGAGTATAGATTGCTTTGGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-2733s21c1
Sequence:CCGGAGGGAAATTACAGGTATTATTCTCGAGAATAATACCTGTAATTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015732.4-623s21c1
Sequence:CCGGGCATACCTCTTCCGGACTTTCCTCGAGGAAAGTCCGGAAGAGGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015732.4-2956s21c1
Sequence:CCGGTACGCAACAGCCACGAAATATCTCGAGATATTTCGTGGCTGTTGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015732.3-3843s1c1
Sequence:CCGGCGCTCGGGTTTGTGTTAAGTTCTCGAGAACTTAACACAAACCCGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-729s1c1
Sequence:CCGGGCAATCTATAAGAGGTACATTCTCGAGAATGTACCTCTTATAGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-1621s1c1
Sequence:CCGGGCTATGAAGAGGACCCACAAACTCGAGTTTGTGGGTCCTCTTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015732.3-2610s1c1
Sequence:CCGGGAGCTGGTTGTCACCTACTTTCTCGAGAAAGTAGGTGACAACCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015732.3-1167s1c1
Sequence:CCGGCCAGTCAATCCTTATCACGTACTCGAGTACGTGATAAGGATTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks