EMAIL THIS PAGE TO A FRIEND

AXL

AXL receptor tyrosine kinase

151 Gene Product Result for
Synonyms: JTK11 UFO
UniProtKB ID: P30530, Q8N5L2, Q9UD27
Gene ID:
Human(558) Summary: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(26362) AXL receptor tyrosine kinase
Rat(308444) Axl receptor tyrosine kinase
Thale Cress(817802) AXR1-like protein
cow(516598) AXL receptor tyrosine kinase
Horse(100064907) AXL receptor tyrosine kinase
domestic cat(101086688) AXL receptor tyrosine kinase
dog(484490) AXL receptor tyrosine kinase
sheep(101102750) AXL receptor tyrosine kinase
domestic guinea pig(100729961) AXL receptor tyrosine kinase
naked mole-rat(101701026) AXL receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A2441 Anti-Axl antibody produced in goat affinity isolated antibody, lyophilized powder mouse, human (10%)
ELISA, western blot pricing
SAB1409509 Anti-AXL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA037423 Anti-AXL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA037422 Anti-AXL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411078 Anti-AXL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1304647 ANTI-MOUSE AXL (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504605 Anti-phospho-AXL (pTyr691) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
WH0000558M1 Monoclonal Anti-AXL antibody produced in mouse clone 6C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200618 Monoclonal Anti-AXL antibody produced in mouse ~1.0 mg/mL, clone AXL188, purified immunoglobulin human, monkey
flow cytometry, immunofluorescence, western blot pricing
SAB1403595 Monoclonal Anti-AXL antibody produced in mouse clone 6G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300515 Monoclonal Anti-AXL antibody produced in mouse clone 1B3A2, ascites fluid human
ELISA, western blot pricing
SAB5300516 Monoclonal Anti-AXL antibody produced in mouse clone 7E10, ascites fluid human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001699 siRNAs that have been validated in the lab human pricing
NM_021913 Rosetta Predictions human pricing
NM_001013147 Rosetta Predictions rat pricing
NM_031794 Rosetta Predictions rat pricing
NM_009465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001699 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047869 validated 2367
1 SASI_Hs01_00047868 validated 2607
1 SASI_Hs01_00047870 validated 2009
2 SASI_Hs01_00047871 predicted 2557
3 SASI_Hs01_00047872 predicted 534
4 SASI_Hs01_00047873 predicted 2432
5 SASI_Hs02_00332366 predicted 2609
6 SASI_Hs01_00047874 predicted 2084
7 SASI_Hs01_00047875 predicted 381
8 SASI_Hs01_00047877 predicted 2290
9 SASI_Hs02_00332367 predicted 2259
10 SASI_Hs01_00047876 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041732 predicted 2629
2 SASI_Hs01_00041734 predicted 2032
3 SASI_Hs01_00041735 predicted 2581
4 SASI_Hs01_00041736 predicted 537
5 SASI_Hs01_00041737 predicted 2464
6 SASI_Hs02_00355192 predicted 2638
7 SASI_Hs01_00041738 predicted 2111
8 SASI_Hs01_00041739 predicted 378
9 SASI_Hs01_00041741 predicted 2321
10 SASI_Hs02_00355193 predicted 2283
11 SASI_Hs01_00041733 predicted 2390
12 SASI_Hs01_00041740 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041934 predicted 1867
2 SASI_Rn01_00041935 predicted 526
3 SASI_Rn02_00200872 predicted 2011
4 SASI_Rn01_00041936 predicted 2089
5 SASI_Rn01_00041937 predicted 2398
6 SASI_Rn01_00041938 predicted 1518
7 SASI_Rn02_00200873 predicted 1484
8 SASI_Rn01_00041939 predicted 298
9 SASI_Rn01_00041940 predicted 2253
10 SASI_Rn01_00041941 predicted 989
11 SASI_Rn01_00041942 predicted 663
12 SASI_Rn01_00041943 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058178 predicted 1894
2 SASI_Rn01_00058179 predicted 531
3 SASI_Rn02_00265233 predicted 2043
4 SASI_Rn01_00058180 predicted 2111
5 SASI_Rn01_00058181 predicted 2420
6 SASI_Rn01_00058182 predicted 1546
7 SASI_Rn02_00265234 predicted 1515
8 SASI_Rn01_00058183 predicted 302
9 SASI_Rn01_00058184 predicted 2280
10 SASI_Rn01_00058185 predicted 986
11 SASI_Rn01_00058186 predicted 660
12 SASI_Rn01_00058187 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060445 predicted 2179
2 SASI_Mm01_00060446 predicted 1511
3 SASI_Mm01_00060447 predicted 1693
4 SASI_Mm01_00060448 predicted 2109
5 SASI_Mm01_00060449 predicted 1979
6 SASI_Mm01_00060450 predicted 392
7 SASI_Mm01_00060451 predicted 1605
8 SASI_Mm01_00060452 predicted 279
9 SASI_Mm01_00060453 predicted 1466
10 SASI_Mm02_00316189 predicted 2341
11 SASI_Mm01_00060444 predicted 1895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001699
VALIDATED
AXL MISSION shRNA Bacterial Glycerol Stock
AXL receptor tyrosine kinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-2576s1c1
Sequence:CCGGGATTGCCATTGAGAGTCTAGCCTCGAGGCTAGACTCTCAATGGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-798s1c1
Sequence:CCGGCAGTACCAGTGTTTGGTGTTTCTCGAGAAACACCAAACACTGGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-2687s1c1
Sequence:CCGGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-4464s1c1
Sequence:CCGGCCTAAGCATCTAAGTTATAAGCTCGAGCTTATAACTTAGATGCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001699.x-4548s1c1
Sequence:CCGGCTTTAGGTTCTTTGCTGCATTCTCGAGAATGCAGCAAAGAACCTAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001699.x-1854s1c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001699.x-2882s1c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001699.x-2187s1c1
Sequence:CCGGGCGGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001699
VALIDATED
AXL MISSION shRNA shRNA Plasmid DNA
AXL receptor tyrosine kinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-2576s1c1
Sequence:CCGGGATTGCCATTGAGAGTCTAGCCTCGAGGCTAGACTCTCAATGGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-798s1c1
Sequence:CCGGCAGTACCAGTGTTTGGTGTTTCTCGAGAAACACCAAACACTGGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-2687s1c1
Sequence:CCGGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-4464s1c1
Sequence:CCGGCCTAAGCATCTAAGTTATAAGCTCGAGCTTATAACTTAGATGCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001699.x-4548s1c1
Sequence:CCGGCTTTAGGTTCTTTGCTGCATTCTCGAGAATGCAGCAAAGAACCTAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001699.x-1854s1c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001699.x-2882s1c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001699.x-2187s1c1
Sequence:CCGGGCGGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001699
VALIDATED
AXL MISSION shRNA Lentiviral Transduction Particles
AXL receptor tyrosine kinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-2576s1c1
Sequence:CCGGGATTGCCATTGAGAGTCTAGCCTCGAGGCTAGACTCTCAATGGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-798s1c1
Sequence:CCGGCAGTACCAGTGTTTGGTGTTTCTCGAGAAACACCAAACACTGGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-2687s1c1
Sequence:CCGGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001699.3-4464s1c1
Sequence:CCGGCCTAAGCATCTAAGTTATAAGCTCGAGCTTATAACTTAGATGCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001699.x-4548s1c1
Sequence:CCGGCTTTAGGTTCTTTGCTGCATTCTCGAGAATGCAGCAAAGAACCTAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001699.x-1854s1c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001699.x-2882s1c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001699.x-2187s1c1
Sequence:CCGGGCGGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009465
VALIDATED
AXL MISSION shRNA Bacterial Glycerol Stock
AXL receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-1174s1c1
Sequence:CCGGCCCGAGGTACTTATGGATATACTCGAGTATATCCATAAGTACCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-265s1c1
Sequence:CCGGCAGATCCTAGAACTGGCTGATCTCGAGATCAGCCAGTTCTAGGATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009465.2-2179s1c1
Sequence:CCGGCCAGTCAAGTGGATTGCTATTCTCGAGAATAGCAATCCACTTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-1801s1c1
Sequence:CCGGGCTGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-2179s21c1
Sequence:CCGGCCAGTCAAGTGGATTGCTATTCTCGAGAATAGCAATCCACTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-3144s21c1
Sequence:CCGGACCTAAGGCTTCTAGACTTTACTCGAGTAAAGTCTAGAAGCCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-265s21c1
Sequence:CCGGCAGATCCTAGAACTGGCTGATCTCGAGATCAGCCAGTTCTAGGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-2332s21c1
Sequence:CCGGCGTCAAGGAAATCGGCTGAAACTCGAGTTTCAGCCGATTTCCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009465
VALIDATED
AXL MISSION shRNA shRNA Plasmid DNA
AXL receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-1174s1c1
Sequence:CCGGCCCGAGGTACTTATGGATATACTCGAGTATATCCATAAGTACCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-265s1c1
Sequence:CCGGCAGATCCTAGAACTGGCTGATCTCGAGATCAGCCAGTTCTAGGATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009465.2-2179s1c1
Sequence:CCGGCCAGTCAAGTGGATTGCTATTCTCGAGAATAGCAATCCACTTGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-1801s1c1
Sequence:CCGGGCTGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-2179s21c1
Sequence:CCGGCCAGTCAAGTGGATTGCTATTCTCGAGAATAGCAATCCACTTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-3144s21c1
Sequence:CCGGACCTAAGGCTTCTAGACTTTACTCGAGTAAAGTCTAGAAGCCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-265s21c1
Sequence:CCGGCAGATCCTAGAACTGGCTGATCTCGAGATCAGCCAGTTCTAGGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-2332s21c1
Sequence:CCGGCGTCAAGGAAATCGGCTGAAACTCGAGTTTCAGCCGATTTCCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009465
VALIDATED
AXL MISSION shRNA Lentiviral Transduction Particles
AXL receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-1174s1c1
Sequence:CCGGCCCGAGGTACTTATGGATATACTCGAGTATATCCATAAGTACCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-265s1c1
Sequence:CCGGCAGATCCTAGAACTGGCTGATCTCGAGATCAGCCAGTTCTAGGATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009465.2-2179s1c1
Sequence:CCGGCCAGTCAAGTGGATTGCTATTCTCGAGAATAGCAATCCACTTGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009465.2-1801s1c1
Sequence:CCGGGCTGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-2179s21c1
Sequence:CCGGCCAGTCAAGTGGATTGCTATTCTCGAGAATAGCAATCCACTTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-3144s21c1
Sequence:CCGGACCTAAGGCTTCTAGACTTTACTCGAGTAAAGTCTAGAAGCCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-265s21c1
Sequence:CCGGCAGATCCTAGAACTGGCTGATCTCGAGATCAGCCAGTTCTAGGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009465.3-2332s21c1
Sequence:CCGGCGTCAAGGAAATCGGCTGAAACTCGAGTTTCAGCCGATTTCCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021913
VALIDATED
AXL MISSION shRNA Bacterial Glycerol Stock
AXL receptor tyrosine kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-4575s1c1
Sequence:CCGGCTTTAGGTTCTTTGCTGCATTCTCGAGAATGCAGCAAAGAACCTAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2151s1c1
Sequence:CCGGGCTGTGAAGACGATGAAGATTCTCGAGAATCTTCATCGTCTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2214s1c1
Sequence:CCGGGCGGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-1881s1c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2909s1c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2335s21c1
Sequence:CCGGGATTGCCATTGAGAGTCTAGCCTCGAGGCTAGACTCTCAATGGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-1613s21c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2641s21c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2446s21c1
Sequence:CCGGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021913
VALIDATED
AXL MISSION shRNA shRNA Plasmid DNA
AXL receptor tyrosine kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-4575s1c1
Sequence:CCGGCTTTAGGTTCTTTGCTGCATTCTCGAGAATGCAGCAAAGAACCTAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2151s1c1
Sequence:CCGGGCTGTGAAGACGATGAAGATTCTCGAGAATCTTCATCGTCTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2214s1c1
Sequence:CCGGGCGGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-1881s1c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2909s1c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2335s21c1
Sequence:CCGGGATTGCCATTGAGAGTCTAGCCTCGAGGCTAGACTCTCAATGGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-1613s21c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2641s21c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2446s21c1
Sequence:CCGGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021913
VALIDATED
AXL MISSION shRNA Lentiviral Transduction Particles
AXL receptor tyrosine kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-4575s1c1
Sequence:CCGGCTTTAGGTTCTTTGCTGCATTCTCGAGAATGCAGCAAAGAACCTAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2151s1c1
Sequence:CCGGGCTGTGAAGACGATGAAGATTCTCGAGAATCTTCATCGTCTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2214s1c1
Sequence:CCGGGCGGTCTGCATGAAGGAATTTCTCGAGAAATTCCTTCATGCAGACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-1881s1c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021913.x-2909s1c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2335s21c1
Sequence:CCGGGATTGCCATTGAGAGTCTAGCCTCGAGGCTAGACTCTCAATGGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-1613s21c1
Sequence:CCGGCGAAAGAAGGAGACCCGTTATCTCGAGATAACGGGTCTCCTTCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2641s21c1
Sequence:CCGGCGAAATCCTCTATGTCAACATCTCGAGATGTTGACATAGAGGATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021913.3-2446s21c1
Sequence:CCGGCGTGGAGAACAGCGAGATTTACTCGAGTAAATCTCGCTGTTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)