EMAIL THIS PAGE TO A FRIEND

AZGP1

alpha-2-glycoprotein 1, zinc-binding

58 Gene Product Result for
Synonyms: ZA2G ZAG
UniProtKB ID: P25311, D6W5T8, O60386, Q5XKQ4, Q8N4N0
Gene ID:
Mouse(12007) alpha-2-glycoprotein 1, zinc
Rat(25294) alpha-2-glycoprotein 1, zinc-binding
dog(479739) alpha-2-glycoprotein 1, zinc-binding
cow(508800) alpha-2-glycoprotein 1, zinc-binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104461 MISSION® esiRNA esiRNA human AZGP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001185 Rosetta Predictions human pricing
NM_012826 Rosetta Predictions rat pricing
NM_013478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331318 predicted 408
2 SASI_Hs02_00331319 predicted 440
3 SASI_Hs02_00331320 predicted 210
4 SASI_Hs01_00074844 predicted 198
5 SASI_Hs01_00074845 predicted 456
6 SASI_Hs01_00074846 predicted 384
7 SASI_Hs01_00074847 predicted 394
8 SASI_Hs02_00331321 predicted 456
9 SASI_Hs02_00331322 predicted 440
10 SASI_Hs01_00074848 predicted 369
11 SASI_Hs01_00074841 predicted 958
12 SASI_Hs01_00074842 predicted 731
13 SASI_Hs01_00074843 predicted 342
14 SASI_Hs01_00074849 predicted 355
15 SASI_Hs01_00074850 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100381 predicted 947
2 SASI_Rn01_00100382 predicted 646
3 SASI_Rn01_00100383 predicted 414
4 SASI_Rn01_00100384 predicted 682
5 SASI_Rn01_00100385 predicted 694
6 SASI_Rn01_00100386 predicted 322
7 SASI_Rn01_00100387 predicted 909
8 SASI_Rn01_00100388 predicted 826
9 SASI_Rn01_00100389 predicted 464
10 SASI_Rn01_00100390 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129188 predicted 851
2 SASI_Mm01_00129189 predicted 498
3 SASI_Mm01_00129190 predicted 700
4 SASI_Mm01_00129191 predicted 620
5 SASI_Mm01_00129192 predicted 755
6 SASI_Mm01_00129193 predicted 741
7 SASI_Mm01_00129194 predicted 488
8 SASI_Mm01_00129195 predicted 970
9 SASI_Mm01_00129196 predicted 613
10 SASI_Mm02_00322118 predicted 996
11 SASI_Mm01_00129197 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001185
AZGP1 MISSION shRNA Bacterial Glycerol Stock
alpha-2-glycoprotein 1, zinc-binding
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-209s1c1
Sequence:CCGGCCTCCAGTTCTTTAGATACAACTCGAGTTGTATCTAAAGAACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-434s1c1
Sequence:CCGGCAGCGGAGCATTCTGGAAATACTCGAGTATTTCCAGAATGCTCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-801s1c1
Sequence:CCGGGATGTTCTTCACAATGGAAATCTCGAGATTTCCATTGTGAAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-407s1c1
Sequence:CCGGTGGTTGTGAGATCGAGAATAACTCGAGTTATTCTCGATCTCACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-610s1c1
Sequence:CCGGCTCTGCGGAAATACCTGAAATCTCGAGATTTCAGGTATTTCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001185.2-375s21c1
Sequence:CCGGAGTAACGGGTCTCACGTATTGCTCGAGCAATACGTGAGACCCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001185.2-123s21c1
Sequence:CCGGCGTTACTCTCTGACCTATATCCTCGAGGATATAGGTCAGAGAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001185
AZGP1 MISSION shRNA shRNA Plasmid DNA
alpha-2-glycoprotein 1, zinc-binding
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-209s1c1
Sequence:CCGGCCTCCAGTTCTTTAGATACAACTCGAGTTGTATCTAAAGAACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-434s1c1
Sequence:CCGGCAGCGGAGCATTCTGGAAATACTCGAGTATTTCCAGAATGCTCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-801s1c1
Sequence:CCGGGATGTTCTTCACAATGGAAATCTCGAGATTTCCATTGTGAAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-407s1c1
Sequence:CCGGTGGTTGTGAGATCGAGAATAACTCGAGTTATTCTCGATCTCACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-610s1c1
Sequence:CCGGCTCTGCGGAAATACCTGAAATCTCGAGATTTCAGGTATTTCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001185.2-375s21c1
Sequence:CCGGAGTAACGGGTCTCACGTATTGCTCGAGCAATACGTGAGACCCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001185.2-123s21c1
Sequence:CCGGCGTTACTCTCTGACCTATATCCTCGAGGATATAGGTCAGAGAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001185
AZGP1 MISSION shRNA Lentiviral Transduction Particles
alpha-2-glycoprotein 1, zinc-binding
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-209s1c1
Sequence:CCGGCCTCCAGTTCTTTAGATACAACTCGAGTTGTATCTAAAGAACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-434s1c1
Sequence:CCGGCAGCGGAGCATTCTGGAAATACTCGAGTATTTCCAGAATGCTCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-801s1c1
Sequence:CCGGGATGTTCTTCACAATGGAAATCTCGAGATTTCCATTGTGAAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-407s1c1
Sequence:CCGGTGGTTGTGAGATCGAGAATAACTCGAGTTATTCTCGATCTCACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001185.2-610s1c1
Sequence:CCGGCTCTGCGGAAATACCTGAAATCTCGAGATTTCAGGTATTTCCGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001185.2-375s21c1
Sequence:CCGGAGTAACGGGTCTCACGTATTGCTCGAGCAATACGTGAGACCCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001185.2-123s21c1
Sequence:CCGGCGTTACTCTCTGACCTATATCCTCGAGGATATAGGTCAGAGAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013478
VALIDATED
AZGP1 MISSION shRNA Bacterial Glycerol Stock
alpha-2-glycoprotein 1, zinc-binding
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-1110s1c1
Sequence:CCGGCCTCCTTGATTAATCTGTCAACTCGAGTTGACAGATTAATCAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-353s1c1
Sequence:CCGGGCGAGATCACAAATAACAGAACTCGAGTTCTGTTATTTGTGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013478.1-328s1c1
Sequence:CCGGCACACCTTTCAGGGAATGTTTCTCGAGAAACATTCCCTGAAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013478.1-327s1c1
Sequence:CCGGTCACACCTTTCAGGGAATGTTCTCGAGAACATTCCCTGAAAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-709s1c1
Sequence:CCGGGCCAACAAGAAGCTAGCATTTCTCGAGAAATGCTAGCTTCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013478
VALIDATED
AZGP1 MISSION shRNA shRNA Plasmid DNA
alpha-2-glycoprotein 1, zinc-binding
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-1110s1c1
Sequence:CCGGCCTCCTTGATTAATCTGTCAACTCGAGTTGACAGATTAATCAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-353s1c1
Sequence:CCGGGCGAGATCACAAATAACAGAACTCGAGTTCTGTTATTTGTGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013478.1-328s1c1
Sequence:CCGGCACACCTTTCAGGGAATGTTTCTCGAGAAACATTCCCTGAAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013478.1-327s1c1
Sequence:CCGGTCACACCTTTCAGGGAATGTTCTCGAGAACATTCCCTGAAAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-709s1c1
Sequence:CCGGGCCAACAAGAAGCTAGCATTTCTCGAGAAATGCTAGCTTCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013478
VALIDATED
AZGP1 MISSION shRNA Lentiviral Transduction Particles
alpha-2-glycoprotein 1, zinc-binding
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-1110s1c1
Sequence:CCGGCCTCCTTGATTAATCTGTCAACTCGAGTTGACAGATTAATCAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-353s1c1
Sequence:CCGGGCGAGATCACAAATAACAGAACTCGAGTTCTGTTATTTGTGATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013478.1-328s1c1
Sequence:CCGGCACACCTTTCAGGGAATGTTTCTCGAGAAACATTCCCTGAAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013478.1-327s1c1
Sequence:CCGGTCACACCTTTCAGGGAATGTTCTCGAGAACATTCCCTGAAAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013478.1-709s1c1
Sequence:CCGGGCCAACAAGAAGCTAGCATTTCTCGAGAAATGCTAGCTTCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks