EMAIL THIS PAGE TO A FRIEND

AZI1

5-azacytidine induced 1

69 Gene Product Result for
Synonyms: AZ1 Cep131 ZA1
UniProtKB ID: Q9UPN4, A6NHI8, B2RN11, Q96F50
Gene ID:
Mouse(12009) 5-azacytidine induced gene 1
Rat(360672) 5-azacytidine induced 1
Zebrafish(563066) 5-azacytidine induced gene 1
cow(514944) 5-azacytidine induced 1
Horse(100056159) 5-azacytidine induced 1
chicken(422074) 5-azacytidine induced 1
domestic cat(101096430) 5-azacytidine induced 1
dog(483359) 5-azacytidine induced 1
Thale Cress(826859) azelaic acid induced 1
domestic guinea pig(100734975) 5-azacytidine induced 1
naked mole-rat(101698051) 5-azacytidine induced 1
sheep(101119062) 5-azacytidine induced 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500923 Anti-AZI1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
HPA024019 Anti-CEP131 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014984 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009811 Rosetta Predictions human pricing
NM_014984 Rosetta Predictions human pricing
NM_001108310 Rosetta Predictions rat pricing
NM_001109658 Rosetta Predictions mouse pricing
NM_009734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184412 predicted 2072
2 SASI_Hs01_00184413 predicted 2847
3 SASI_Hs02_00305685 predicted 602
4 SASI_Hs01_00184414 predicted 726
5 SASI_Hs01_00184415 predicted 2966
6 SASI_Hs01_00184416 predicted 910
7 SASI_Hs01_00184417 predicted 787
8 SASI_Hs01_00184418 predicted 693
9 SASI_Hs02_00305686 predicted 1696
10 SASI_Hs01_00184420 predicted 1738
11 SASI_Hs01_00184419 predicted 989
12 SASI_Hs01_00184421 predicted 2766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085433 predicted 2074
2 SASI_Hs01_00085434 predicted 2962
3 SASI_Hs02_00346722 predicted 600
4 SASI_Hs01_00085435 predicted 733
5 SASI_Hs01_00085436 predicted 3077
6 SASI_Hs01_00085437 predicted 909
7 SASI_Hs01_00085438 predicted 792
8 SASI_Hs01_00085439 predicted 702
9 SASI_Hs02_00346723 predicted 1693
10 SASI_Hs01_00085441 predicted 1740
11 SASI_Hs01_00085440 predicted 991
12 SASI_Hs01_00085442 predicted 2882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237399 predicted 2907
2 SASI_Rn02_00237400 predicted 3084
3 SASI_Rn02_00237401 predicted 3358
4 SASI_Rn02_00237402 predicted 2852
5 SASI_Rn02_00237403 predicted 943
6 SASI_Rn02_00237404 predicted 2266
7 SASI_Rn02_00237405 predicted 709
8 SASI_Rn02_00237406 predicted 235
9 SASI_Rn02_00237407 predicted 2261
10 SASI_Rn02_00237408 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304104 predicted 2022
2 SASI_Mm02_00304105 predicted 2167
3 SASI_Mm02_00304106 predicted 750
4 SASI_Mm02_00304107 predicted 2886
5 SASI_Mm02_00304108 predicted 2258
6 SASI_Mm02_00304109 predicted 2240
7 SASI_Mm02_00304110 predicted 954
8 SASI_Mm02_00304111 predicted 2842
9 SASI_Mm02_00304112 predicted 3281
10 SASI_Mm02_00304113 predicted 3229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150364 predicted 2025
2 SASI_Mm01_00150365 predicted 2169
3 SASI_Mm01_00150366 predicted 746
4 SASI_Mm01_00150368 predicted 2895
5 SASI_Mm01_00150369 predicted 2256
6 SASI_Mm01_00150370 predicted 2244
7 SASI_Mm01_00150371 predicted 961
8 SASI_Mm01_00150372 predicted 2842
9 SASI_Mm02_00316899 predicted 3284
10 SASI_Mm01_00150373 predicted 3236
11 SASI_Mm01_00150367 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009734
VALIDATED
AZI1 MISSION shRNA Bacterial Glycerol Stock
5-azacytidine induced 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-2197s21c1
Sequence:CCGGGCGTGAGAAGTGGATCAATGACTCGAGTCATTGATCCACTTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-242s21c1
Sequence:CCGGGCTGTGGACTTGAGTCTGATTCTCGAGAATCAGACTCAAGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-399s21c1
Sequence:CCGGCTATCAACAATCTTCGAAGATCTCGAGATCTTCGAAGATTGTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.2-961s1c1
Sequence:CCGGGAGGTTCATCCATCAGGTAAACTCGAGTTTACCTGATGGATGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-691s21c1
Sequence:CCGGCGCTAACAACAGGAGCAACAACTCGAGTTGTTGCTCCTGTTGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-1913s1c1
Sequence:CCGGCCTCACTGTTCGACGTGTTAACTCGAGTTAACACGTCGAACAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-2807s1c1
Sequence:CCGGCCAGGAGATTGAGTTGGTCATCTCGAGATGACCAACTCAATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009734.1-2189s1c1
Sequence:CCGGGCGTGAGAAGTGGATCAATGACTCGAGTCATTGATCCACTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-234s1c1
Sequence:CCGGGCTGTGGACTTGAGTCTGATTCTCGAGAATCAGACTCAAGTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-683s1c1
Sequence:CCGGCGCTAACAACAGGAGCAACAACTCGAGTTGTTGCTCCTGTTGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-391s1c1
Sequence:CCGGCTATCAACAATCTTCGAAGATCTCGAGATCTTCGAAGATTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-1998s1c1
Sequence:CCGGCAACGGCACTTGTCCTTCATTCTCGAGAATGAAGGACAAGTGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009734
VALIDATED
AZI1 MISSION shRNA shRNA Plasmid DNA
5-azacytidine induced 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-2197s21c1
Sequence:CCGGGCGTGAGAAGTGGATCAATGACTCGAGTCATTGATCCACTTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-242s21c1
Sequence:CCGGGCTGTGGACTTGAGTCTGATTCTCGAGAATCAGACTCAAGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-399s21c1
Sequence:CCGGCTATCAACAATCTTCGAAGATCTCGAGATCTTCGAAGATTGTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.2-961s1c1
Sequence:CCGGGAGGTTCATCCATCAGGTAAACTCGAGTTTACCTGATGGATGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-691s21c1
Sequence:CCGGCGCTAACAACAGGAGCAACAACTCGAGTTGTTGCTCCTGTTGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-1913s1c1
Sequence:CCGGCCTCACTGTTCGACGTGTTAACTCGAGTTAACACGTCGAACAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-2807s1c1
Sequence:CCGGCCAGGAGATTGAGTTGGTCATCTCGAGATGACCAACTCAATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009734.1-2189s1c1
Sequence:CCGGGCGTGAGAAGTGGATCAATGACTCGAGTCATTGATCCACTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-234s1c1
Sequence:CCGGGCTGTGGACTTGAGTCTGATTCTCGAGAATCAGACTCAAGTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-683s1c1
Sequence:CCGGCGCTAACAACAGGAGCAACAACTCGAGTTGTTGCTCCTGTTGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-391s1c1
Sequence:CCGGCTATCAACAATCTTCGAAGATCTCGAGATCTTCGAAGATTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-1998s1c1
Sequence:CCGGCAACGGCACTTGTCCTTCATTCTCGAGAATGAAGGACAAGTGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009734
VALIDATED
AZI1 MISSION shRNA Lentiviral Transduction Particles
5-azacytidine induced 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-2197s21c1
Sequence:CCGGGCGTGAGAAGTGGATCAATGACTCGAGTCATTGATCCACTTCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-242s21c1
Sequence:CCGGGCTGTGGACTTGAGTCTGATTCTCGAGAATCAGACTCAAGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-399s21c1
Sequence:CCGGCTATCAACAATCTTCGAAGATCTCGAGATCTTCGAAGATTGTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.2-961s1c1
Sequence:CCGGGAGGTTCATCCATCAGGTAAACTCGAGTTTACCTGATGGATGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009734.2-691s21c1
Sequence:CCGGCGCTAACAACAGGAGCAACAACTCGAGTTGTTGCTCCTGTTGTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-1913s1c1
Sequence:CCGGCCTCACTGTTCGACGTGTTAACTCGAGTTAACACGTCGAACAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-2807s1c1
Sequence:CCGGCCAGGAGATTGAGTTGGTCATCTCGAGATGACCAACTCAATCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009734.1-2189s1c1
Sequence:CCGGGCGTGAGAAGTGGATCAATGACTCGAGTCATTGATCCACTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-234s1c1
Sequence:CCGGGCTGTGGACTTGAGTCTGATTCTCGAGAATCAGACTCAAGTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-683s1c1
Sequence:CCGGCGCTAACAACAGGAGCAACAACTCGAGTTGTTGCTCCTGTTGTTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009734.1-391s1c1
Sequence:CCGGCTATCAACAATCTTCGAAGATCTCGAGATCTTCGAAGATTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009734.1-1998s1c1
Sequence:CCGGCAACGGCACTTGTCCTTCATTCTCGAGAATGAAGGACAAGTGCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014984
AZI1 MISSION shRNA Bacterial Glycerol Stock
5-azacytidine induced 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-975s21c1
Sequence:CCGGGAGGAGGCTGAGAGGTTTATCCTCGAGGATAAACCTCTCAGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-2205s21c1
Sequence:CCGGCAGCACGAGCTGGAGATTAAACTCGAGTTTAATCTCCAGCTCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014984.2-3457s21c1
Sequence:CCGGGAACACTGTCGAAGAACGGAACTCGAGTTCCGTTCTTCGACAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-1369s21c1
Sequence:CCGGAGGCCCTCAAGGCCAACAATACTCGAGTATTGTTGGCCTTGAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-1763s21c1
Sequence:CCGGATCGGAGGCCAAGCTACAAAGCTCGAGCTTTGTAGCTTGGCCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014984.1-410s1c1
Sequence:CCGGCAACAACCTTAGAAGATCCAACTCGAGTTGGATCTTCTAAGGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-986s1c1
Sequence:CCGGGAGGTTTATCCACCAGGTGAACTCGAGTTCACCTGGTGGATAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014984.1-3457s1c1
Sequence:CCGGGAACACTGTCGAAGAACGGAACTCGAGTTCCGTTCTTCGACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014984.1-2096s1c1
Sequence:CCGGCCAGCTGATTGAGGACAAGAACTCGAGTTCTTGTCCTCAATCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-2747s1c1
Sequence:CCGGGATGGAGCTGAATACCCTGAACTCGAGTTCAGGGTATTCAGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-2339s1c1
Sequence:CCGGGAAGCTGATTGCAAGGCACAACTCGAGTTGTGCCTTGCAATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014984.1-3449s1c1
Sequence:CCGGGATGCCGGGAACACTGTCGAACTCGAGTTCGACAGTGTTCCCGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-701s1c1
Sequence:CCGGCACTGCTAACAACAGGAGCAACTCGAGTTGCTCCTGTTGTTAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014984
AZI1 MISSION shRNA shRNA Plasmid DNA
5-azacytidine induced 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-975s21c1
Sequence:CCGGGAGGAGGCTGAGAGGTTTATCCTCGAGGATAAACCTCTCAGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-2205s21c1
Sequence:CCGGCAGCACGAGCTGGAGATTAAACTCGAGTTTAATCTCCAGCTCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014984.2-3457s21c1
Sequence:CCGGGAACACTGTCGAAGAACGGAACTCGAGTTCCGTTCTTCGACAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-1369s21c1
Sequence:CCGGAGGCCCTCAAGGCCAACAATACTCGAGTATTGTTGGCCTTGAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-1763s21c1
Sequence:CCGGATCGGAGGCCAAGCTACAAAGCTCGAGCTTTGTAGCTTGGCCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014984.1-410s1c1
Sequence:CCGGCAACAACCTTAGAAGATCCAACTCGAGTTGGATCTTCTAAGGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-986s1c1
Sequence:CCGGGAGGTTTATCCACCAGGTGAACTCGAGTTCACCTGGTGGATAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014984.1-3457s1c1
Sequence:CCGGGAACACTGTCGAAGAACGGAACTCGAGTTCCGTTCTTCGACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014984.1-2096s1c1
Sequence:CCGGCCAGCTGATTGAGGACAAGAACTCGAGTTCTTGTCCTCAATCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-2747s1c1
Sequence:CCGGGATGGAGCTGAATACCCTGAACTCGAGTTCAGGGTATTCAGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-2339s1c1
Sequence:CCGGGAAGCTGATTGCAAGGCACAACTCGAGTTGTGCCTTGCAATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014984.1-3449s1c1
Sequence:CCGGGATGCCGGGAACACTGTCGAACTCGAGTTCGACAGTGTTCCCGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-701s1c1
Sequence:CCGGCACTGCTAACAACAGGAGCAACTCGAGTTGCTCCTGTTGTTAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014984
AZI1 MISSION shRNA Lentiviral Transduction Particles
5-azacytidine induced 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-975s21c1
Sequence:CCGGGAGGAGGCTGAGAGGTTTATCCTCGAGGATAAACCTCTCAGCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-2205s21c1
Sequence:CCGGCAGCACGAGCTGGAGATTAAACTCGAGTTTAATCTCCAGCTCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014984.2-3457s21c1
Sequence:CCGGGAACACTGTCGAAGAACGGAACTCGAGTTCCGTTCTTCGACAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-1369s21c1
Sequence:CCGGAGGCCCTCAAGGCCAACAATACTCGAGTATTGTTGGCCTTGAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014984.2-1763s21c1
Sequence:CCGGATCGGAGGCCAAGCTACAAAGCTCGAGCTTTGTAGCTTGGCCTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014984.1-410s1c1
Sequence:CCGGCAACAACCTTAGAAGATCCAACTCGAGTTGGATCTTCTAAGGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-986s1c1
Sequence:CCGGGAGGTTTATCCACCAGGTGAACTCGAGTTCACCTGGTGGATAAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014984.1-3457s1c1
Sequence:CCGGGAACACTGTCGAAGAACGGAACTCGAGTTCCGTTCTTCGACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014984.1-2096s1c1
Sequence:CCGGCCAGCTGATTGAGGACAAGAACTCGAGTTCTTGTCCTCAATCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-2747s1c1
Sequence:CCGGGATGGAGCTGAATACCCTGAACTCGAGTTCAGGGTATTCAGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-2339s1c1
Sequence:CCGGGAAGCTGATTGCAAGGCACAACTCGAGTTGTGCCTTGCAATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014984.1-3449s1c1
Sequence:CCGGGATGCCGGGAACACTGTCGAACTCGAGTTCGACAGTGTTCCCGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014984.1-701s1c1
Sequence:CCGGCACTGCTAACAACAGGAGCAACTCGAGTTGCTCCTGTTGTTAGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks