EMAIL THIS PAGE TO A FRIEND

AZI2

5-azacytidine induced 2

64 Gene Product Result for
Synonyms: AZ2 NAP1 TILP
UniProtKB ID: Q9H6S1, A8K3M2, C9JB40, H7BXU6, Q86W99, Q9BQF1
Gene ID:
Human(64343) Summary: AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]
Mouse(27215) 5-azacytidine induced gene 2
Rat(316051) 5-azacytidine induced 2
sheep(101103677) 5-azacytidine induced 2
Domestic Rabbit(100342816) 5-azacytidine induced 2
naked mole-rat(101701773) 5-azacytidine induced 2
domestic guinea pig(100719572) 5-azacytidine induced 2
Zebrafish(406377) 5-azacytidine induced 2
cow(767932) 5-azacytidine induced 2
Horse(100051113) 5-azacytidine induced 2
domestic cat(101088428) 5-azacytidine induced 2
dog(485632) 5-azacytidine induced 2
chicken(420660) 5-azacytidine induced 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022461 Rosetta Predictions human pricing
NM_001025705 Rosetta Predictions rat pricing
NM_001048146 Rosetta Predictions mouse pricing
NM_013727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355732 predicted 1064
2 SASI_Hs01_00033692 predicted 839
3 SASI_Hs01_00033693 predicted 1347
4 SASI_Hs01_00033694 predicted 649
5 SASI_Hs01_00033695 predicted 763
6 SASI_Hs01_00033696 predicted 1122
7 SASI_Hs01_00033697 predicted 1428
8 SASI_Hs01_00033698 predicted 498
9 SASI_Hs01_00033700 predicted 534
10 SASI_Hs01_00033701 predicted 1488
11 SASI_Hs01_00033699 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115053 predicted 1658
2 SASI_Rn01_00115055 predicted 485
3 SASI_Rn01_00115056 predicted 1371
4 SASI_Rn01_00115057 predicted 1430
5 SASI_Rn01_00115058 predicted 514
6 SASI_Rn01_00115060 predicted 1430
7 SASI_Rn02_00203322 predicted 660
8 SASI_Rn01_00115061 predicted 575
9 SASI_Rn01_00115062 predicted 869
10 SASI_Rn02_00203323 predicted 486
11 SASI_Rn01_00115054 predicted 1418
12 SASI_Rn01_00115059 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292061 predicted 988
2 SASI_Mm02_00292062 predicted 704
3 SASI_Mm02_00292063 predicted 859
4 SASI_Mm02_00292064 predicted 559
5 SASI_Mm02_00292065 predicted 757
6 SASI_Mm02_00292066 predicted 483
7 SASI_Mm02_00292067 predicted 538
8 SASI_Mm02_00292068 predicted 968
9 SASI_Mm02_00292069 predicted 735
10 SASI_Mm02_00292070 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322652 predicted 996
2 SASI_Mm01_00040212 predicted 703
3 SASI_Mm01_00040216 predicted 858
4 SASI_Mm02_00322653 predicted 555
5 SASI_Mm02_00322654 predicted 753
6 SASI_Mm02_00322655 predicted 478
7 SASI_Mm02_00322656 predicted 541
8 SASI_Mm02_00322657 predicted 968
9 SASI_Mm02_00322658 predicted 736
10 SASI_Mm02_00322659 predicted 957
11 SASI_Mm01_00040211 predicted 986
12 SASI_Mm01_00040213 predicted 917
13 SASI_Mm01_00040214 predicted 967
14 SASI_Mm01_00040215 predicted 1552
15 SASI_Mm01_00040217 predicted 1545
16 SASI_Mm01_00040218 predicted 1011
17 SASI_Mm01_00040219 predicted 1344
18 SASI_Mm01_00040220 predicted 1565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022461
AZI2 MISSION shRNA Bacterial Glycerol Stock
5-azacytidine induced 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022461.2-1963s1c1
Sequence:CCGGGCCTCTCAGAAGAATGGAATTCTCGAGAATTCCATTCTTCTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-772s1c1
Sequence:CCGGGCATATCGAGAGGTTTGCATTCTCGAGAATGCAAACCTCTCGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1618s1c1
Sequence:CCGGCCACTGCATTACTTGGATCAACTCGAGTTGATCCAAGTAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1149s1c1
Sequence:CCGGGCATGCATACTGGGAACTGAACTCGAGTTCAGTTCCCAGTATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1463s1c1
Sequence:CCGGCCATTCCTAATGATGGTACATCTCGAGATGTACCATCATTAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022461.3-1896s21c1
Sequence:CCGGGCACCCTCTAGCTCCATATTCCTCGAGGAATATGGAGCTAGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022461.3-1246s21c1
Sequence:CCGGAGTACAAGCTGAACTACTAAGCTCGAGCTTAGTAGTTCAGCTTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022461.3-1712s21c1
Sequence:CCGGTTTGGAAGAGATTCACGATTTCTCGAGAAATCGTGAATCTCTTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022461
AZI2 MISSION shRNA shRNA Plasmid DNA
5-azacytidine induced 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022461.2-1963s1c1
Sequence:CCGGGCCTCTCAGAAGAATGGAATTCTCGAGAATTCCATTCTTCTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-772s1c1
Sequence:CCGGGCATATCGAGAGGTTTGCATTCTCGAGAATGCAAACCTCTCGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1618s1c1
Sequence:CCGGCCACTGCATTACTTGGATCAACTCGAGTTGATCCAAGTAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1149s1c1
Sequence:CCGGGCATGCATACTGGGAACTGAACTCGAGTTCAGTTCCCAGTATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1463s1c1
Sequence:CCGGCCATTCCTAATGATGGTACATCTCGAGATGTACCATCATTAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022461.3-1896s21c1
Sequence:CCGGGCACCCTCTAGCTCCATATTCCTCGAGGAATATGGAGCTAGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022461.3-1246s21c1
Sequence:CCGGAGTACAAGCTGAACTACTAAGCTCGAGCTTAGTAGTTCAGCTTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022461.3-1712s21c1
Sequence:CCGGTTTGGAAGAGATTCACGATTTCTCGAGAAATCGTGAATCTCTTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022461
AZI2 MISSION shRNA Lentiviral Transduction Particles
5-azacytidine induced 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022461.2-1963s1c1
Sequence:CCGGGCCTCTCAGAAGAATGGAATTCTCGAGAATTCCATTCTTCTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-772s1c1
Sequence:CCGGGCATATCGAGAGGTTTGCATTCTCGAGAATGCAAACCTCTCGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1618s1c1
Sequence:CCGGCCACTGCATTACTTGGATCAACTCGAGTTGATCCAAGTAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1149s1c1
Sequence:CCGGGCATGCATACTGGGAACTGAACTCGAGTTCAGTTCCCAGTATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022461.2-1463s1c1
Sequence:CCGGCCATTCCTAATGATGGTACATCTCGAGATGTACCATCATTAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022461.3-1896s21c1
Sequence:CCGGGCACCCTCTAGCTCCATATTCCTCGAGGAATATGGAGCTAGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022461.3-1246s21c1
Sequence:CCGGAGTACAAGCTGAACTACTAAGCTCGAGCTTAGTAGTTCAGCTTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022461.3-1712s21c1
Sequence:CCGGTTTGGAAGAGATTCACGATTTCTCGAGAAATCGTGAATCTCTTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013727
VALIDATED
AZI2 MISSION shRNA Bacterial Glycerol Stock
5-azacytidine induced 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013727.2-1122s1c1
Sequence:CCGGGCACGAAATTGCACTTGACAACTCGAGTTGTCAAGTGCAATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-1749s1c1
Sequence:CCGGCCTGCCTAAATATCCAATCATCTCGAGATGATTGGATATTTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-392s1c1
Sequence:CCGGGCACTGGTCACTGCTTATGAACTCGAGTTCATAAGCAGTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-662s1c1
Sequence:CCGGCAGTCTAAAGAAGTAGAACTTCTCGAGAAGTTCTACTTCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013727.2-560s1c1
Sequence:CCGGGCATATCGTGAGGTTTGCATTCTCGAGAATGCAAACCTCACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-853s21c1
Sequence:CCGGCAGTCTAAAGAAGTAGAACTTCTCGAGAAGTTCTACTTCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-583s21c1
Sequence:CCGGGCACTGGTCACTGCTTATGAACTCGAGTTCATAAGCAGTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013727.3-2100s21c1
Sequence:CCGGTTATGACATCTCTATGCTATTCTCGAGAATAGCATAGAGATGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-1184s21c1
Sequence:CCGGAGAGGGAGATGTCTAACTTACCTCGAGGTAAGTTAGACATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-1313s21c1
Sequence:CCGGGCACGAAATTGCACTTGACAACTCGAGTTGTCAAGTGCAATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013727
VALIDATED
AZI2 MISSION shRNA shRNA Plasmid DNA
5-azacytidine induced 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013727.2-1122s1c1
Sequence:CCGGGCACGAAATTGCACTTGACAACTCGAGTTGTCAAGTGCAATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-1749s1c1
Sequence:CCGGCCTGCCTAAATATCCAATCATCTCGAGATGATTGGATATTTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-392s1c1
Sequence:CCGGGCACTGGTCACTGCTTATGAACTCGAGTTCATAAGCAGTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-662s1c1
Sequence:CCGGCAGTCTAAAGAAGTAGAACTTCTCGAGAAGTTCTACTTCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013727.2-560s1c1
Sequence:CCGGGCATATCGTGAGGTTTGCATTCTCGAGAATGCAAACCTCACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-853s21c1
Sequence:CCGGCAGTCTAAAGAAGTAGAACTTCTCGAGAAGTTCTACTTCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-583s21c1
Sequence:CCGGGCACTGGTCACTGCTTATGAACTCGAGTTCATAAGCAGTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013727.3-2100s21c1
Sequence:CCGGTTATGACATCTCTATGCTATTCTCGAGAATAGCATAGAGATGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-1184s21c1
Sequence:CCGGAGAGGGAGATGTCTAACTTACCTCGAGGTAAGTTAGACATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-1313s21c1
Sequence:CCGGGCACGAAATTGCACTTGACAACTCGAGTTGTCAAGTGCAATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013727
VALIDATED
AZI2 MISSION shRNA Lentiviral Transduction Particles
5-azacytidine induced 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013727.2-1122s1c1
Sequence:CCGGGCACGAAATTGCACTTGACAACTCGAGTTGTCAAGTGCAATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-1749s1c1
Sequence:CCGGCCTGCCTAAATATCCAATCATCTCGAGATGATTGGATATTTAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-392s1c1
Sequence:CCGGGCACTGGTCACTGCTTATGAACTCGAGTTCATAAGCAGTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013727.2-662s1c1
Sequence:CCGGCAGTCTAAAGAAGTAGAACTTCTCGAGAAGTTCTACTTCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013727.2-560s1c1
Sequence:CCGGGCATATCGTGAGGTTTGCATTCTCGAGAATGCAAACCTCACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-853s21c1
Sequence:CCGGCAGTCTAAAGAAGTAGAACTTCTCGAGAAGTTCTACTTCTTTAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-583s21c1
Sequence:CCGGGCACTGGTCACTGCTTATGAACTCGAGTTCATAAGCAGTGACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013727.3-2100s21c1
Sequence:CCGGTTATGACATCTCTATGCTATTCTCGAGAATAGCATAGAGATGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-1184s21c1
Sequence:CCGGAGAGGGAGATGTCTAACTTACCTCGAGGTAAGTTAGACATCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013727.3-1313s21c1
Sequence:CCGGGCACGAAATTGCACTTGACAACTCGAGTTGTCAAGTGCAATTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks