EMAIL THIS PAGE TO A FRIEND

AZIN1

antizyme inhibitor 1

222 Gene Product Result for
Synonyms: OAZI OAZIN ODC1L
UniProtKB ID: O14977, A6NCD5, Q6IBQ7, Q96D20
Gene ID:
Human(51582) Summary: Ornithine decarboxylase (ODC) catalyzes the conversion of ornithine to putrescine in the first and apparently rate-limiting step in polyamine biosynthesis. Ornithine decarboxylase antizymes play a role in the regulation of polyamine synthesis by binding to and inhibiting ornithine decarboxylase. The protein encoded by this gene is highly similar to ODC. It binds to ODC antizyme and stabilizes ODC, thus inhibiting antizyme-mediated ODC degradation. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54375) antizyme inhibitor 1
Rat(58961) antizyme inhibitor 1
chicken(420254) antizyme inhibitor 1
dog(475058) antizyme inhibitor 1
domestic cat(101100539) antizyme inhibitor 1
cow(532835) antizyme inhibitor 1
Horse(100056267) antizyme inhibitor 1
domestic guinea pig(100729426) antizyme inhibitor 1
naked mole-rat(101721609) antizyme inhibitor 1
sheep(101122702) antizyme inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015878 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015878 Rosetta Predictions human pricing
NM_148174 Rosetta Predictions human pricing
NM_022585 Rosetta Predictions rat pricing
NM_001102458 Rosetta Predictions mouse pricing
NM_018745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232747 predicted 1165
2 SASI_Hs01_00232749 predicted 1292
3 SASI_Hs01_00232750 predicted 1191
4 SASI_Hs01_00232752 predicted 1417
5 SASI_Hs01_00232753 predicted 942
6 SASI_Hs02_00348459 predicted 1192
7 SASI_Hs01_00232754 predicted 1425
8 SASI_Hs01_00232755 predicted 1407
9 SASI_Hs02_00348460 predicted 1518
10 SASI_Hs02_00348461 predicted 1176
11 SASI_Hs01_00232748 predicted 1814
12 SASI_Hs01_00232751 predicted 2093
13 SASI_Hs01_00232756 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228354 predicted 1023
2 SASI_Hs01_00228356 predicted 1150
3 SASI_Hs01_00228357 predicted 1037
4 SASI_Hs01_00228359 predicted 1273
5 SASI_Hs01_00228360 predicted 803
6 SASI_Hs02_00365562 predicted 1042
7 SASI_Hs01_00228361 predicted 1282
8 SASI_Hs01_00228362 predicted 1261
9 SASI_Hs02_00365563 predicted 1377
10 SASI_Hs02_00365564 predicted 1031
11 SASI_Hs01_00228355 predicted 1671
12 SASI_Hs01_00228358 predicted 1947
13 SASI_Hs01_00228363 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034764 predicted 2017
2 SASI_Rn01_00034765 predicted 2153
3 SASI_Rn01_00034766 predicted 2078
4 SASI_Rn02_00263326 predicted 1275
5 SASI_Rn01_00034767 predicted 2111
6 SASI_Rn01_00034768 predicted 1116
7 SASI_Rn01_00034772 predicted 1969
8 SASI_Rn01_00034773 predicted 1175
9 SASI_Rn02_00263327 predicted 818
10 SASI_Rn02_00263328 predicted 786
11 SASI_Rn01_00034769 predicted 1569
12 SASI_Rn01_00034770 predicted 1167
13 SASI_Rn01_00034771 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302893 predicted 1817
2 SASI_Mm02_00302894 predicted 1582
3 SASI_Mm02_00302895 predicted 1182
4 SASI_Mm02_00302896 predicted 1410
5 SASI_Mm02_00302897 predicted 1081
6 SASI_Mm02_00302898 predicted 1077
7 SASI_Mm02_00302899 predicted 880
8 SASI_Mm02_00302900 predicted 1717
9 SASI_Mm02_00302901 predicted 1525
10 SASI_Mm02_00302902 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201747 predicted 1656
2 SASI_Mm01_00201748 predicted 1427
3 SASI_Mm01_00201750 predicted 1025
4 SASI_Mm01_00201751 predicted 1252
5 SASI_Mm01_00201753 predicted 921
6 SASI_Mm01_00201755 predicted 918
7 SASI_Mm02_00324004 predicted 720
8 SASI_Mm02_00324005 predicted 1562
9 SASI_Mm02_00324006 predicted 1370
10 SASI_Mm02_00324007 predicted 881
11 SASI_Mm01_00201749 predicted 1149
12 SASI_Mm01_00201752 predicted 1038
13 SASI_Mm01_00201754 predicted 678
14 SASI_Mm01_00201756 predicted 1275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018745
VALIDATED
AZIN1 MISSION shRNA Bacterial Glycerol Stock
antizyme inhibitor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1662s21c1
Sequence:CCGGTGTGATGAGCTTGATCAAATTCTCGAGAATTTGATCAAGCTCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1429s21c1
Sequence:CCGGCGTTTACACTTGCAGTCAATACTCGAGTATTGACTGCAAGTGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1345s21c1
Sequence:CCGGTCAGTCCTCTGTTGGATATTTCTCGAGAAATATCCAACAGAGGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018745.5-2309s21c1
Sequence:CCGGATGTCTTTCACCCAGATATATCTCGAGATATATCTGGGTGAAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-629s21c1
Sequence:CCGGCCTGTTGGATGAAGGAACAAACTCGAGTTTGTTCCTTCATCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018745.2-3034s1c1
Sequence:CCGGGCACACTTTCTCACTTGTAATCTCGAGATTACAAGTGAGAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018745.2-1430s1c1
Sequence:CCGGCGTTTACACTTGCAGTCAATACTCGAGTATTGACTGCAAGTGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018745.2-630s1c1
Sequence:CCGGCCTGTTGGATGAAGGAACAAACTCGAGTTTGTTCCTTCATCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018745.2-1791s1c1
Sequence:CCGGGCCAGCTATTTATTTCATGATCTCGAGATCATGAAATAAATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018745.2-1522s1c1
Sequence:CCGGGCCTTCGTGTATTACATGAATCTCGAGATTCATGTAATACACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018745
VALIDATED
AZIN1 MISSION shRNA shRNA Plasmid DNA
antizyme inhibitor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1662s21c1
Sequence:CCGGTGTGATGAGCTTGATCAAATTCTCGAGAATTTGATCAAGCTCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1429s21c1
Sequence:CCGGCGTTTACACTTGCAGTCAATACTCGAGTATTGACTGCAAGTGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1345s21c1
Sequence:CCGGTCAGTCCTCTGTTGGATATTTCTCGAGAAATATCCAACAGAGGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018745.5-2309s21c1
Sequence:CCGGATGTCTTTCACCCAGATATATCTCGAGATATATCTGGGTGAAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-629s21c1
Sequence:CCGGCCTGTTGGATGAAGGAACAAACTCGAGTTTGTTCCTTCATCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018745.2-3034s1c1
Sequence:CCGGGCACACTTTCTCACTTGTAATCTCGAGATTACAAGTGAGAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018745.2-1430s1c1
Sequence:CCGGCGTTTACACTTGCAGTCAATACTCGAGTATTGACTGCAAGTGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018745.2-630s1c1
Sequence:CCGGCCTGTTGGATGAAGGAACAAACTCGAGTTTGTTCCTTCATCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018745.2-1791s1c1
Sequence:CCGGGCCAGCTATTTATTTCATGATCTCGAGATCATGAAATAAATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018745.2-1522s1c1
Sequence:CCGGGCCTTCGTGTATTACATGAATCTCGAGATTCATGTAATACACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018745
VALIDATED
AZIN1 MISSION shRNA Lentiviral Transduction Particles
antizyme inhibitor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1662s21c1
Sequence:CCGGTGTGATGAGCTTGATCAAATTCTCGAGAATTTGATCAAGCTCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1429s21c1
Sequence:CCGGCGTTTACACTTGCAGTCAATACTCGAGTATTGACTGCAAGTGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-1345s21c1
Sequence:CCGGTCAGTCCTCTGTTGGATATTTCTCGAGAAATATCCAACAGAGGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018745.5-2309s21c1
Sequence:CCGGATGTCTTTCACCCAGATATATCTCGAGATATATCTGGGTGAAAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018745.5-629s21c1
Sequence:CCGGCCTGTTGGATGAAGGAACAAACTCGAGTTTGTTCCTTCATCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115396    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018745.2-3034s1c1
Sequence:CCGGGCACACTTTCTCACTTGTAATCTCGAGATTACAAGTGAGAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018745.2-1430s1c1
Sequence:CCGGCGTTTACACTTGCAGTCAATACTCGAGTATTGACTGCAAGTGTAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018745.2-630s1c1
Sequence:CCGGCCTGTTGGATGAAGGAACAAACTCGAGTTTGTTCCTTCATCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018745.2-1791s1c1
Sequence:CCGGGCCAGCTATTTATTTCATGATCTCGAGATCATGAAATAAATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018745.2-1522s1c1
Sequence:CCGGGCCTTCGTGTATTACATGAATCTCGAGATTCATGTAATACACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015878
VALIDATED
AZIN1 MISSION shRNA Bacterial Glycerol Stock
antizyme inhibitor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-997s21c1
Sequence:CCGGCGGATTTGCTTGTTCCAGTAACTCGAGTTACTGGAACAAGCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-1187s21c1
Sequence:CCGGGCCAAGGTCTTACTACATATTCTCGAGAATATGTAGTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-907s21c1
Sequence:CCGGGCAGAATGTAGTGGCTCAGATCTCGAGATCTGAGCCACTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-2367s21c1
Sequence:CCGGTGGAGATGGAAGCCCATTAATCTCGAGATTAATGGGCTTCCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015878.4-1814s21c1
Sequence:CCGGTGTGATGAGCTTGATCAAATTCTCGAGAATTTGATCAAGCTCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015878.3-1569s1c1
Sequence:CCGGCGCAGTTAATATCATAGCAAACTCGAGTTTGCTATGATATTAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-975s1c1
Sequence:CCGGCGGATTTGCTTGTTCCAGTAACTCGAGTTACTGGAACAAGCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-1321s1c1
Sequence:CCGGGCTTGCAAAGAATCTCAAGTACTCGAGTACTTGAGATTCTTTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-1165s1c1
Sequence:CCGGGCCAAGGTCTTACTACATATTCTCGAGAATATGTAGTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-885s1c1
Sequence:CCGGGCAGAATGTAGTGGCTCAGATCTCGAGATCTGAGCCACTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015878
VALIDATED
AZIN1 MISSION shRNA shRNA Plasmid DNA
antizyme inhibitor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-997s21c1
Sequence:CCGGCGGATTTGCTTGTTCCAGTAACTCGAGTTACTGGAACAAGCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-1187s21c1
Sequence:CCGGGCCAAGGTCTTACTACATATTCTCGAGAATATGTAGTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-907s21c1
Sequence:CCGGGCAGAATGTAGTGGCTCAGATCTCGAGATCTGAGCCACTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-2367s21c1
Sequence:CCGGTGGAGATGGAAGCCCATTAATCTCGAGATTAATGGGCTTCCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015878.4-1814s21c1
Sequence:CCGGTGTGATGAGCTTGATCAAATTCTCGAGAATTTGATCAAGCTCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015878.3-1569s1c1
Sequence:CCGGCGCAGTTAATATCATAGCAAACTCGAGTTTGCTATGATATTAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-975s1c1
Sequence:CCGGCGGATTTGCTTGTTCCAGTAACTCGAGTTACTGGAACAAGCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-1321s1c1
Sequence:CCGGGCTTGCAAAGAATCTCAAGTACTCGAGTACTTGAGATTCTTTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-1165s1c1
Sequence:CCGGGCCAAGGTCTTACTACATATTCTCGAGAATATGTAGTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-885s1c1
Sequence:CCGGGCAGAATGTAGTGGCTCAGATCTCGAGATCTGAGCCACTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015878
VALIDATED
AZIN1 MISSION shRNA Lentiviral Transduction Particles
antizyme inhibitor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-997s21c1
Sequence:CCGGCGGATTTGCTTGTTCCAGTAACTCGAGTTACTGGAACAAGCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-1187s21c1
Sequence:CCGGGCCAAGGTCTTACTACATATTCTCGAGAATATGTAGTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-907s21c1
Sequence:CCGGGCAGAATGTAGTGGCTCAGATCTCGAGATCTGAGCCACTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015878.4-2367s21c1
Sequence:CCGGTGGAGATGGAAGCCCATTAATCTCGAGATTAATGGGCTTCCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015878.4-1814s21c1
Sequence:CCGGTGTGATGAGCTTGATCAAATTCTCGAGAATTTGATCAAGCTCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015878.3-1569s1c1
Sequence:CCGGCGCAGTTAATATCATAGCAAACTCGAGTTTGCTATGATATTAACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-975s1c1
Sequence:CCGGCGGATTTGCTTGTTCCAGTAACTCGAGTTACTGGAACAAGCAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-1321s1c1
Sequence:CCGGGCTTGCAAAGAATCTCAAGTACTCGAGTACTTGAGATTCTTTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-1165s1c1
Sequence:CCGGGCCAAGGTCTTACTACATATTCTCGAGAATATGTAGTAAGACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015878.3-885s1c1
Sequence:CCGGGCAGAATGTAGTGGCTCAGATCTCGAGATCTGAGCCACTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks