EMAIL THIS PAGE TO A FRIEND

AZU1

azurocidin 1

28 Gene Product Result for
Synonyms: AZAMP AZU CAP37 HBP HUMAZUR NAZC
UniProtKB ID: P20160, P80014, Q52LG4, Q9UCM1, Q9UCT5
Gene ID:
Human(566) Summary: Azurophil granules, specialized lysosomes of the neutrophil, contain at least 10 proteins implicated in the killing of microorganisms. The protein encoded by this gene is an azurophil granule antibiotic protein, with monocyte chemotactic and antibacterial activity. It is also an important multifunctional inflammatory mediator. This encoded protein is a member of the serine protease gene family but it is not a serine proteinase, because the active site serine and histidine residues are replaced. The genes encoding this protein, neutrophil elastase 2, and proteinase 3 are in a cluster located at chromosome 19pter. All 3 genes are expressed coordinately and their protein products are packaged together into azurophil granules during neutrophil differentiation. [provided by RefSeq, Jul 2008]
cow(100336938) azurocidin 1
sheep(101110329) azurocidin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001700 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125001 MISSION® esiRNA esiRNA human AZU1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001700 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107793 predicted 390
2 SASI_Hs01_00107794 predicted 285
3 SASI_Hs01_00107795 predicted 202
4 SASI_Hs02_00332368 predicted 414
5 SASI_Hs01_00107797 predicted 562
6 SASI_Hs01_00107798 predicted 508
7 SASI_Hs02_00332369 predicted 359
8 SASI_Hs01_00107799 predicted 373
9 SASI_Hs01_00107800 predicted 400
10 SASI_Hs01_00107801 predicted 287
11 SASI_Hs01_00107796 predicted 206
12 SASI_Hs01_00107802 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001700
AZU1 MISSION shRNA Bacterial Glycerol Stock
azurocidin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-722s1c1
Sequence:CCGGCGAGACTGGATCGATGGTGTTCTCGAGAACACCATCGATCCAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-145s1c1
Sequence:CCGGCATTCAGAATCAAGGCAGGCACTCGAGTGCCTGCCTTGATTCTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-319s1c1
Sequence:CCGGCATGAGCGAGAATGGCTACGACTCGAGTCGTAGCCATTCTCGCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-730s1c1
Sequence:CCGGGATCGATGGTGTTCTCAACAACTCGAGTTGTTGAGAACACCATCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-515s1c1
Sequence:CCGGCCCAGGTTTGTCAACGTGACTCTCGAGAGTCACGTTGACAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-348s21c1
Sequence:CCGGAGAACCTGAACGACCTGATGCCTCGAGGCATCAGGTCGTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-396s21c1
Sequence:CCGGTCACCAGCAGCGTGACGATACCTCGAGGTATCGTCACGCTGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-186s21c1
Sequence:CCGGTCCATGCCCGCTTCGTGATGACTCGAGTCATCACGAAGCGGGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-215s21c1
Sequence:CCGGAGCTGCTTCCAAAGCCAGAACCTCGAGGTTCTGGCTTTGGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001700
AZU1 MISSION shRNA shRNA Plasmid DNA
azurocidin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-722s1c1
Sequence:CCGGCGAGACTGGATCGATGGTGTTCTCGAGAACACCATCGATCCAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-145s1c1
Sequence:CCGGCATTCAGAATCAAGGCAGGCACTCGAGTGCCTGCCTTGATTCTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-319s1c1
Sequence:CCGGCATGAGCGAGAATGGCTACGACTCGAGTCGTAGCCATTCTCGCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-730s1c1
Sequence:CCGGGATCGATGGTGTTCTCAACAACTCGAGTTGTTGAGAACACCATCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-515s1c1
Sequence:CCGGCCCAGGTTTGTCAACGTGACTCTCGAGAGTCACGTTGACAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-348s21c1
Sequence:CCGGAGAACCTGAACGACCTGATGCCTCGAGGCATCAGGTCGTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-396s21c1
Sequence:CCGGTCACCAGCAGCGTGACGATACCTCGAGGTATCGTCACGCTGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-186s21c1
Sequence:CCGGTCCATGCCCGCTTCGTGATGACTCGAGTCATCACGAAGCGGGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-215s21c1
Sequence:CCGGAGCTGCTTCCAAAGCCAGAACCTCGAGGTTCTGGCTTTGGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001700
AZU1 MISSION shRNA Lentiviral Transduction Particles
azurocidin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-722s1c1
Sequence:CCGGCGAGACTGGATCGATGGTGTTCTCGAGAACACCATCGATCCAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-145s1c1
Sequence:CCGGCATTCAGAATCAAGGCAGGCACTCGAGTGCCTGCCTTGATTCTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-319s1c1
Sequence:CCGGCATGAGCGAGAATGGCTACGACTCGAGTCGTAGCCATTCTCGCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-730s1c1
Sequence:CCGGGATCGATGGTGTTCTCAACAACTCGAGTTGTTGAGAACACCATCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001700.3-515s1c1
Sequence:CCGGCCCAGGTTTGTCAACGTGACTCTCGAGAGTCACGTTGACAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-348s21c1
Sequence:CCGGAGAACCTGAACGACCTGATGCCTCGAGGCATCAGGTCGTTCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-396s21c1
Sequence:CCGGTCACCAGCAGCGTGACGATACCTCGAGGTATCGTCACGCTGCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-186s21c1
Sequence:CCGGTCCATGCCCGCTTCGTGATGACTCGAGTCATCACGAAGCGGGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001700.3-215s21c1
Sequence:CCGGAGCTGCTTCCAAAGCCAGAACCTCGAGGTTCTGGCTTTGGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks