EMAIL THIS PAGE TO A FRIEND

B2M

beta-2-microglobulin

83 Gene Product Result for
Gene ID:
Human(567) Summary: This gene encodes a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells. The protein has a predominantly beta-pleated sheet structure that can form amyloid fibrils in some pathological conditions. A mutation in this gene has been shown to result in hypercatabolic hypoproteinemia.[provided by RefSeq, Sep 2009]
Mouse(12010) beta-2 microglobulin
Rat(24223) beta-2 microglobulin
naked mole-rat(101702715) beta-2-microglobulin
domestic guinea pig(100379556) beta-2 microglobulin
sheep(443295) beta-2-microglobulin
Zebrafish(30400) beta-2-microglobulin
cow(280729) beta-2-microglobulin
Horse(100034203) beta-2-microglobulin
domestic cat(494145) beta-2-microglobulin
dog(100855741) beta-2-microglobulin
dog(478284) beta-2-microglobulin
chicken(414830) beta-2-microglobulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW20030F Anti-β-2-Microglobulin antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
M8523 Anti-β2-Microglobulin antibody produced in rabbit whole antiserum human
ELISA pricing
SAB2502066 Anti-B2M (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, western blot pricing
SAB2502067 Anti-B2M antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human
ELISA, western blot pricing
SAB2701869 Anti-b2m antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA006361 Anti-B2M antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105109 Anti-B2M, (N-terminal) antibody produced in rabbit affinity isolated antibody sheep, human, horse, rabbit, guinea pig
western blot pricing
M7398 Monoclonal Anti-β2-Microglobulin antibody produced in mouse clone BM-63, ascites fluid human
ELISA, immunofluorescence pricing
WH0000567M1 Monoclonal Anti-B2M antibody produced in mouse clone 3F9-2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403596 Monoclonal Anti-B2M antibody produced in mouse clone 3F2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4700010 Monoclonal Anti-B2M antibody produced in mouse clone B2M-01, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700014 Monoclonal Anti-B2M antibody produced in mouse clone B2M-02, purified immunoglobulin, buffered aqueous solution human, pig
flow cytometry pricing
SAB4700011 Monoclonal Anti-B2M-Biotin antibody produced in mouse clone B2M-01, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700015 Monoclonal Anti-B2M-Biotin antibody produced in mouse clone B2M-02, purified immunoglobulin, buffered aqueous solution pig, human
flow cytometry pricing
SAB4700012 Monoclonal Anti-B2M-FITC antibody produced in mouse clone B2M-01, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700013 Monoclonal Anti-B2M-PE antibody produced in mouse clone B2M-01, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0474 AQUA Peptide VEHSDLSFS[K] human pricing
AQ0473 AQUA Peptide VNHVTLSQP[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004048 Rosetta Predictions human pricing
NM_012512 Rosetta Predictions rat pricing
NM_009735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056031 predicted 530
2 SASI_Hs02_00336807 predicted 697
3 SASI_Hs01_00056032 predicted 268
4 SASI_Hs01_00056033 predicted 438
5 SASI_Hs01_00056035 predicted 709
6 SASI_Hs02_00336808 predicted 238
7 SASI_Hs01_00056036 predicted 426
8 SASI_Hs01_00056037 predicted 561
9 SASI_Hs01_00056039 predicted 212
10 SASI_Hs02_00336809 predicted 424
11 SASI_Hs01_00056030 predicted 445
12 SASI_Hs01_00056034 predicted 222
13 SASI_Hs01_00056038 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103340 predicted 234
2 SASI_Rn01_00103341 predicted 289
3 SASI_Rn01_00103342 predicted 279
4 SASI_Rn01_00103343 predicted 273
5 SASI_Rn01_00103344 predicted 275
6 SASI_Rn02_00259566 predicted 254
7 SASI_Rn01_00103345 predicted 235
8 SASI_Rn01_00103346 predicted 276
9 SASI_Rn01_00103347 predicted 288
10 SASI_Rn01_00103348 predicted 214
11 SASI_Rn01_00103349 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085471 predicted 490
2 SASI_Mm01_00085472 predicted 394
3 SASI_Mm01_00085473 predicted 376
4 SASI_Mm01_00085474 predicted 426
5 SASI_Mm01_00085475 predicted 512
6 SASI_Mm01_00085478 predicted 473
7 SASI_Mm01_00085479 predicted 341
8 SASI_Mm01_00085480 predicted 421
9 SASI_Mm02_00316900 predicted 424
10 SASI_Mm02_00316901 predicted 202
11 SASI_Mm01_00085476 predicted 471
12 SASI_Mm01_00085477 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009735
VALIDATED
B2M MISSION shRNA Bacterial Glycerol Stock
beta-2-microglobulin
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-209s1c1
Sequence:CCGGCGCCTCACATTGAAATCCAAACTCGAGTTTGGATTTCAATGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009735.2-353s1c1
Sequence:CCGGGCAGAGTTAAGCATGCCAGTACTCGAGTACTGGCATGCTTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009735.2-171s1c1
Sequence:CCGGGCCGAACATACTGAACTGCTACTCGAGTAGCAGTTCAGTATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-225s1c1
Sequence:CCGGCCAAATGCTGAAGAACGGGAACTCGAGTTCCCGTTCTTCAGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-102s1c1
Sequence:CCGGCGGCCTGTATGCTATCCAGAACTCGAGTTCTGGATAGCATACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009735.3-387s21c1
Sequence:GTACCGGCGTCTACTGGGATCGAGACATCTCGAGATGTCTCGATCCCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-168s21c1
Sequence:CCGGGCCGAACATACTGAACTGCTACTCGAGTAGCAGTTCAGTATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-463s21c1
Sequence:CCGGCCAGTTTCTAATATGCTATACCTCGAGGTATAGCATATTAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-277s21c1
Sequence:CCGGTTCAGCAAGGACTGGTCTTTCCTCGAGGAAAGACCAGTCCTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-325s21c1
Sequence:CCGGCCCACTGAGACTGATACATACCTCGAGGTATGTATCAGTCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-252s21c1
Sequence:CCGGTAAAGTAGAGATGTCAGATATCTCGAGATATCTGACATCTCTACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009735.3-352s21c1
Sequence:GTACCGGAGAGTTAAGCATGCCAGTATGCTCGAGCATACTGGCATGCTTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009735
VALIDATED
B2M MISSION shRNA shRNA Plasmid DNA
beta-2-microglobulin
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-209s1c1
Sequence:CCGGCGCCTCACATTGAAATCCAAACTCGAGTTTGGATTTCAATGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009735.2-353s1c1
Sequence:CCGGGCAGAGTTAAGCATGCCAGTACTCGAGTACTGGCATGCTTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009735.2-171s1c1
Sequence:CCGGGCCGAACATACTGAACTGCTACTCGAGTAGCAGTTCAGTATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-225s1c1
Sequence:CCGGCCAAATGCTGAAGAACGGGAACTCGAGTTCCCGTTCTTCAGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-102s1c1
Sequence:CCGGCGGCCTGTATGCTATCCAGAACTCGAGTTCTGGATAGCATACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009735.3-387s21c1
Sequence:GTACCGGCGTCTACTGGGATCGAGACATCTCGAGATGTCTCGATCCCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-168s21c1
Sequence:CCGGGCCGAACATACTGAACTGCTACTCGAGTAGCAGTTCAGTATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-463s21c1
Sequence:CCGGCCAGTTTCTAATATGCTATACCTCGAGGTATAGCATATTAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-277s21c1
Sequence:CCGGTTCAGCAAGGACTGGTCTTTCCTCGAGGAAAGACCAGTCCTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-325s21c1
Sequence:CCGGCCCACTGAGACTGATACATACCTCGAGGTATGTATCAGTCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-252s21c1
Sequence:CCGGTAAAGTAGAGATGTCAGATATCTCGAGATATCTGACATCTCTACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009735.3-352s21c1
Sequence:GTACCGGAGAGTTAAGCATGCCAGTATGCTCGAGCATACTGGCATGCTTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009735
VALIDATED
B2M MISSION shRNA Lentiviral Transduction Particles
beta-2-microglobulin
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-209s1c1
Sequence:CCGGCGCCTCACATTGAAATCCAAACTCGAGTTTGGATTTCAATGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009735.2-353s1c1
Sequence:CCGGGCAGAGTTAAGCATGCCAGTACTCGAGTACTGGCATGCTTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009735.2-171s1c1
Sequence:CCGGGCCGAACATACTGAACTGCTACTCGAGTAGCAGTTCAGTATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-225s1c1
Sequence:CCGGCCAAATGCTGAAGAACGGGAACTCGAGTTCCCGTTCTTCAGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009735.2-102s1c1
Sequence:CCGGCGGCCTGTATGCTATCCAGAACTCGAGTTCTGGATAGCATACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009735.3-387s21c1
Sequence:GTACCGGCGTCTACTGGGATCGAGACATCTCGAGATGTCTCGATCCCAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-168s21c1
Sequence:CCGGGCCGAACATACTGAACTGCTACTCGAGTAGCAGTTCAGTATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-463s21c1
Sequence:CCGGCCAGTTTCTAATATGCTATACCTCGAGGTATAGCATATTAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-277s21c1
Sequence:CCGGTTCAGCAAGGACTGGTCTTTCCTCGAGGAAAGACCAGTCCTTGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-325s21c1
Sequence:CCGGCCCACTGAGACTGATACATACCTCGAGGTATGTATCAGTCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009735.3-252s21c1
Sequence:CCGGTAAAGTAGAGATGTCAGATATCTCGAGATATCTGACATCTCTACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009735.3-352s21c1
Sequence:GTACCGGAGAGTTAAGCATGCCAGTATGCTCGAGCATACTGGCATGCTTAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004048
VALIDATED
B2M MISSION shRNA Bacterial Glycerol Stock
beta-2-microglobulin
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-388s1c1
Sequence:CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-217s1c1
Sequence:CCGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-297s1c1
Sequence:CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-161s1c1
Sequence:CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004048.2-360s1c1
Sequence:CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-433s21c1
Sequence:GTACCGGAGGTTTGAAGATGCCGCATTTCTCGAGAAATGCGGCATCTTCAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-297s21c1
Sequence:CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-217s21c1
Sequence:CCGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-388s21c1
Sequence:CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-161s21c1
Sequence:CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-360s21c1
Sequence:CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004048.2-717s21c1
Sequence:GTACCGGTTCAATCTCTTGCACTCAAAGCTCGAGCTTTGAGTGCAAGAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-749s21c1
Sequence:GTACCGGAGTTAAGCGTGCATAAGTTAACTCGAGTTAACTTATGCACGCTTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004048
VALIDATED
B2M MISSION shRNA shRNA Plasmid DNA
beta-2-microglobulin
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-388s1c1
Sequence:CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-217s1c1
Sequence:CCGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-297s1c1
Sequence:CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-161s1c1
Sequence:CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004048.2-360s1c1
Sequence:CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-433s21c1
Sequence:GTACCGGAGGTTTGAAGATGCCGCATTTCTCGAGAAATGCGGCATCTTCAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-297s21c1
Sequence:CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-217s21c1
Sequence:CCGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-388s21c1
Sequence:CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-161s21c1
Sequence:CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-360s21c1
Sequence:CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004048.2-717s21c1
Sequence:GTACCGGTTCAATCTCTTGCACTCAAAGCTCGAGCTTTGAGTGCAAGAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-749s21c1
Sequence:GTACCGGAGTTAAGCGTGCATAAGTTAACTCGAGTTAACTTATGCACGCTTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004048
VALIDATED
B2M MISSION shRNA Lentiviral Transduction Particles
beta-2-microglobulin
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-388s1c1
Sequence:CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-217s1c1
Sequence:CCGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-297s1c1
Sequence:CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004048.2-161s1c1
Sequence:CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004048.2-360s1c1
Sequence:CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-433s21c1
Sequence:GTACCGGAGGTTTGAAGATGCCGCATTTCTCGAGAAATGCGGCATCTTCAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-297s21c1
Sequence:CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-217s21c1
Sequence:CCGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-388s21c1
Sequence:CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-161s21c1
Sequence:CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004048.2-360s21c1
Sequence:CCGGCCGTGTGAACCATGTGACTTTCTCGAGAAAGTCACATGGTTCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004048.2-717s21c1
Sequence:GTACCGGTTCAATCTCTTGCACTCAAAGCTCGAGCTTTGAGTGCAAGAGATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004048.2-749s21c1
Sequence:GTACCGGAGTTAAGCGTGCATAAGTTAACTCGAGTTAACTTATGCACGCTTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks