EMAIL THIS PAGE TO A FRIEND

B3GALNT1

beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)

113 Gene Product Result for
Synonyms: B3GALT3 GLCT3 GLOB Gb4Cer P P1 beta3Gal-T3 galT3
Gene ID:
Human(8706) Summary: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). The encoded protein of this gene does not use N-acetylglucosamine as an acceptor sugar at all. Multiple transcript variants that are alternatively spliced in the 5' UTR have been described; they all encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(26879) UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
Rat(310508) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
naked mole-rat(101706281) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
domestic guinea pig(100729840) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
sheep(101104544) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
chicken(425011) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
dog(100683634) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
cow(767844) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
domestic cat(101092536) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
chicken(425010) beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003781 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038628 Rosetta Predictions human pricing
NM_003781 Rosetta Predictions human pricing
NM_033167 Rosetta Predictions human pricing
NM_033168 Rosetta Predictions human pricing
NM_033169 Rosetta Predictions human pricing
NM_001013158 Rosetta Predictions rat pricing
NM_020026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103487 predicted 1248
2 SASI_Hs01_00103488 predicted 1634
3 SASI_Hs01_00103489 predicted 1553
4 SASI_Hs01_00103490 predicted 1529
5 SASI_Hs01_00103491 predicted 1491
6 SASI_Hs01_00103492 predicted 1176
7 SASI_Hs01_00103493 predicted 1504
8 SASI_Hs01_00103494 predicted 1377
9 SASI_Hs01_00103495 predicted 1385
10 SASI_Hs01_00103496 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032699 predicted 924
2 SASI_Hs01_00032700 predicted 1309
3 SASI_Hs01_00032701 predicted 1225
4 SASI_Hs01_00032702 predicted 1199
5 SASI_Hs01_00032703 predicted 1165
6 SASI_Hs01_00032704 predicted 849
7 SASI_Hs01_00032705 predicted 1178
8 SASI_Hs01_00032706 predicted 1056
9 SASI_Hs01_00032707 predicted 1064
10 SASI_Hs01_00032708 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151919 predicted 1046
2 SASI_Hs01_00151920 predicted 1426
3 SASI_Hs01_00151921 predicted 1343
4 SASI_Hs01_00151922 predicted 1320
5 SASI_Hs01_00151923 predicted 1283
6 SASI_Hs01_00151924 predicted 975
7 SASI_Hs01_00151925 predicted 1299
8 SASI_Hs01_00151926 predicted 1176
9 SASI_Hs01_00151927 predicted 1184
10 SASI_Hs01_00151928 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169513 predicted 834
2 SASI_Hs01_00169514 predicted 1218
3 SASI_Hs01_00169515 predicted 1136
4 SASI_Hs01_00169516 predicted 1110
5 SASI_Hs01_00169517 predicted 1068
6 SASI_Hs01_00169518 predicted 759
7 SASI_Hs01_00169519 predicted 1090
8 SASI_Hs01_00169520 predicted 961
9 SASI_Hs01_00169521 predicted 966
10 SASI_Hs01_00169522 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246931 predicted 895
2 SASI_Hs01_00246932 predicted 1282
3 SASI_Hs01_00246933 predicted 1203
4 SASI_Hs01_00246934 predicted 1178
5 SASI_Hs01_00246935 predicted 1135
6 SASI_Hs01_00246936 predicted 825
7 SASI_Hs01_00246937 predicted 1151
8 SASI_Hs01_00246938 predicted 1033
9 SASI_Hs01_00246939 predicted 1036
10 SASI_Hs01_00246940 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044217 predicted 1177
2 SASI_Rn01_00044218 predicted 472
3 SASI_Rn01_00044219 predicted 352
4 SASI_Rn01_00044220 predicted 639
5 SASI_Rn01_00044221 predicted 751
6 SASI_Rn01_00044223 predicted 1230
7 SASI_Rn01_00044225 predicted 352
8 SASI_Rn01_00044226 predicted 826
9 SASI_Rn02_00200886 predicted 337
10 SASI_Rn02_00200887 predicted 371
11 SASI_Rn01_00044222 predicted 1240
12 SASI_Rn01_00044224 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105283 predicted 944
2 SASI_Mm01_00105284 predicted 319
3 SASI_Mm01_00105285 predicted 308
4 SASI_Mm01_00105286 predicted 429
5 SASI_Mm01_00105287 predicted 945
6 SASI_Mm01_00105288 predicted 575
7 SASI_Mm01_00105289 predicted 937
8 SASI_Mm01_00105290 predicted 786
9 SASI_Mm01_00105291 predicted 957
10 SASI_Mm01_00105292 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003781
VALIDATED
B3GALNT1 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003781.2-2851s1c1
Sequence:CCGGCCCTTGTTAATCTCCATCCATCTCGAGATGGATGGAGATTAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-1208s1c1
Sequence:CCGGCGGGATCTGTTTGAATTTATTCTCGAGAATAAATTCAAACAGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003781.2-1182s1c1
Sequence:CCGGCCCATCAAGTTTGAAGATGTTCTCGAGAACATCTTCAAACTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-566s1c1
Sequence:CCGGGCCGATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-786s1c1
Sequence:CCGGGCATTGTCCTTAGAGGATGAACTCGAGTTCATCCTCTAAGGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-614s21c1
Sequence:CCGGGCCGATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-1256s21c1
Sequence:CCGGCGGGATCTGTTTGAATTTATTCTCGAGAATAAATTCAAACAGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-834s21c1
Sequence:CCGGGCATTGTCCTTAGAGGATGAACTCGAGTTCATCCTCTAAGGACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-1158s21c1
Sequence:CCGGTGCAGTGGGTTGGGTTATATACTCGAGTATATAACCCAACCCACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003781.3-1627s21c1
Sequence:CCGGATGATATGTGGAGGAATTAAACTCGAGTTTAATTCCTCCACATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003781
VALIDATED
B3GALNT1 MISSION shRNA shRNA Plasmid DNA
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003781.2-2851s1c1
Sequence:CCGGCCCTTGTTAATCTCCATCCATCTCGAGATGGATGGAGATTAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-1208s1c1
Sequence:CCGGCGGGATCTGTTTGAATTTATTCTCGAGAATAAATTCAAACAGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003781.2-1182s1c1
Sequence:CCGGCCCATCAAGTTTGAAGATGTTCTCGAGAACATCTTCAAACTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-566s1c1
Sequence:CCGGGCCGATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-786s1c1
Sequence:CCGGGCATTGTCCTTAGAGGATGAACTCGAGTTCATCCTCTAAGGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-614s21c1
Sequence:CCGGGCCGATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-1256s21c1
Sequence:CCGGCGGGATCTGTTTGAATTTATTCTCGAGAATAAATTCAAACAGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-834s21c1
Sequence:CCGGGCATTGTCCTTAGAGGATGAACTCGAGTTCATCCTCTAAGGACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-1158s21c1
Sequence:CCGGTGCAGTGGGTTGGGTTATATACTCGAGTATATAACCCAACCCACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003781.3-1627s21c1
Sequence:CCGGATGATATGTGGAGGAATTAAACTCGAGTTTAATTCCTCCACATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003781
VALIDATED
B3GALNT1 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003781.2-2851s1c1
Sequence:CCGGCCCTTGTTAATCTCCATCCATCTCGAGATGGATGGAGATTAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-1208s1c1
Sequence:CCGGCGGGATCTGTTTGAATTTATTCTCGAGAATAAATTCAAACAGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003781.2-1182s1c1
Sequence:CCGGCCCATCAAGTTTGAAGATGTTCTCGAGAACATCTTCAAACTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-566s1c1
Sequence:CCGGGCCGATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003781.2-786s1c1
Sequence:CCGGGCATTGTCCTTAGAGGATGAACTCGAGTTCATCCTCTAAGGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-614s21c1
Sequence:CCGGGCCGATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-1256s21c1
Sequence:CCGGCGGGATCTGTTTGAATTTATTCTCGAGAATAAATTCAAACAGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-834s21c1
Sequence:CCGGGCATTGTCCTTAGAGGATGAACTCGAGTTCATCCTCTAAGGACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003781.3-1158s21c1
Sequence:CCGGTGCAGTGGGTTGGGTTATATACTCGAGTATATAACCCAACCCACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003781.3-1627s21c1
Sequence:CCGGATGATATGTGGAGGAATTAAACTCGAGTTTAATTCCTCCACATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020026
VALIDATED
B3GALNT1 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-776s1c1
Sequence:CCGGCGGGCTATCCTCTAATTGATACTCGAGTATCAATTAGAGGATAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-828s1c1
Sequence:CCGGCCACATTTCATACCAAGAGTACTCGAGTACTCTTGGTATGAAATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020026.2-947s1c1
Sequence:CCGGCCATCAAGTTTGAAGACGTTTCTCGAGAAACGTCTTCAAACTTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-570s1c1
Sequence:CCGGGCACGTTCTCTATGGTGATATCTCGAGATATCACCATAGAGAACGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-330s1c1
Sequence:CCGGGCCAATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-568s21c1
Sequence:CCGGGCACGTTCTCTATGGTGATATCTCGAGATATCACCATAGAGAACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-826s21c1
Sequence:CCGGCCACATTTCATACCAAGAGTACTCGAGTACTCTTGGTATGAAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020026.3-711s21c1
Sequence:CCGGTCATCAACACTGGCAATTTAGCTCGAGCTAAATTGCCAGTGTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-1538s21c1
Sequence:CCGGGTGTATCTTAAGTGGTTATTACTCGAGTAATAACCACTTAAGATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-317s21c1
Sequence:CCGGTATGAGTATGAGCCAATTTACCTCGAGGTAAATTGGCTCATACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020026
VALIDATED
B3GALNT1 MISSION shRNA shRNA Plasmid DNA
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-776s1c1
Sequence:CCGGCGGGCTATCCTCTAATTGATACTCGAGTATCAATTAGAGGATAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-828s1c1
Sequence:CCGGCCACATTTCATACCAAGAGTACTCGAGTACTCTTGGTATGAAATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020026.2-947s1c1
Sequence:CCGGCCATCAAGTTTGAAGACGTTTCTCGAGAAACGTCTTCAAACTTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-570s1c1
Sequence:CCGGGCACGTTCTCTATGGTGATATCTCGAGATATCACCATAGAGAACGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-330s1c1
Sequence:CCGGGCCAATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-568s21c1
Sequence:CCGGGCACGTTCTCTATGGTGATATCTCGAGATATCACCATAGAGAACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-826s21c1
Sequence:CCGGCCACATTTCATACCAAGAGTACTCGAGTACTCTTGGTATGAAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020026.3-711s21c1
Sequence:CCGGTCATCAACACTGGCAATTTAGCTCGAGCTAAATTGCCAGTGTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-1538s21c1
Sequence:CCGGGTGTATCTTAAGTGGTTATTACTCGAGTAATAACCACTTAAGATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-317s21c1
Sequence:CCGGTATGAGTATGAGCCAATTTACCTCGAGGTAAATTGGCTCATACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020026
VALIDATED
B3GALNT1 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-776s1c1
Sequence:CCGGCGGGCTATCCTCTAATTGATACTCGAGTATCAATTAGAGGATAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-828s1c1
Sequence:CCGGCCACATTTCATACCAAGAGTACTCGAGTACTCTTGGTATGAAATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020026.2-947s1c1
Sequence:CCGGCCATCAAGTTTGAAGACGTTTCTCGAGAAACGTCTTCAAACTTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-570s1c1
Sequence:CCGGGCACGTTCTCTATGGTGATATCTCGAGATATCACCATAGAGAACGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020026.2-330s1c1
Sequence:CCGGGCCAATTTACAGACAAGACTTCTCGAGAAGTCTTGTCTGTAAATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-568s21c1
Sequence:CCGGGCACGTTCTCTATGGTGATATCTCGAGATATCACCATAGAGAACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-826s21c1
Sequence:CCGGCCACATTTCATACCAAGAGTACTCGAGTACTCTTGGTATGAAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020026.3-711s21c1
Sequence:CCGGTCATCAACACTGGCAATTTAGCTCGAGCTAAATTGCCAGTGTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-1538s21c1
Sequence:CCGGGTGTATCTTAAGTGGTTATTACTCGAGTAATAACCACTTAAGATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020026.3-317s21c1
Sequence:CCGGTATGAGTATGAGCCAATTTACCTCGAGGTAAATTGGCTCATACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)