EMAIL THIS PAGE TO A FRIEND

B3GALNT2

beta-1,3-N-acetylgalactosaminyltransferase 2

Synonyms: B3GalNAc-T2 MDDGA11
UniProtKB ID: Q8NCR0, Q59GR3, Q5TCI3, Q96AL7
Gene ID:
Human(148789) Summary: This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Mouse(97884) UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
Rat(291212) beta-1,3-N-acetylgalactosaminyltransferase 2
Zebrafish(553716) beta-1,3-N-acetylgalactosaminyltransferase 2
domestic cat(101085750) beta-1,3-N-acetylgalactosaminyltransferase 2
Horse(100058647) beta-1,3-N-acetylgalactosaminyltransferase 2
cow(100125310) beta-1,3-N-acetylgalactosaminyltransferase 2
dog(479196) beta-1,3-N-acetylgalactosaminyltransferase 2
chicken(430770) beta-1,3-N-acetylgalactosaminyltransferase 2
sheep(101116957) beta-1,3-N-acetylgalactosaminyltransferase 2
Domestic Rabbit(100352278) beta-1,3-N-acetylgalactosaminyltransferase 2
domestic guinea pig(100727876) beta-1,3-N-acetylgalactosaminyltransferase 2
naked mole-rat(101697517) beta-1,3-N-acetylgalactosaminyltransferase 2
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100193 Anti-B3GALNT2 antibody produced in rabbit affinity isolated antibody human, mouse, horse, rabbit, canine, bovine, rat, guinea pig
western blot pricing
SAB2103675 Anti-B3GALNT2 antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, mouse, rabbit, canine, zebrafish, bovine, horse
western blot pricing
HPA050662 Anti-B3GALNT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152490 Rosetta Predictions human pricing
NM_178640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143480 predicted 417
2 SASI_Hs01_00143481 predicted 545
3 SASI_Hs01_00143482 predicted 344
4 SASI_Hs01_00143483 predicted 1000
5 SASI_Hs02_00366266 predicted 861
6 SASI_Hs01_00143485 predicted 414
7 SASI_Hs01_00143486 predicted 1719
8 SASI_Hs01_00143487 predicted 1390
9 SASI_Hs01_00143488 predicted 1256
10 SASI_Hs01_00143489 predicted 839
11 SASI_Hs01_00143484 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042632 predicted 1195
2 SASI_Mm01_00042633 predicted 1378
3 SASI_Mm01_00042634 predicted 501
4 SASI_Mm01_00042636 predicted 326
5 SASI_Mm01_00042637 predicted 584
6 SASI_Mm01_00042639 predicted 720
7 SASI_Mm02_00349037 predicted 561
8 SASI_Mm01_00042640 predicted 363
9 SASI_Mm02_00349038 predicted 1694
10 SASI_Mm02_00349039 predicted 1198
11 SASI_Mm01_00042635 predicted 748
12 SASI_Mm01_00042638 predicted 1704
13 SASI_Mm01_00042641 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152490
VALIDATED
B3GALNT2 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-N-acetylgalactosaminyltransferase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1568s21c1
Sequence:CCGGATGGCTGCCATAGGACCTAAACTCGAGTTTAGGTCCTATGGCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1203s21c1
Sequence:CCGGTTGTCGACACTTATCGTAATGCTCGAGCATTACGATAAGTGTCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1348s21c1
Sequence:CCGGGAATCTGGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-878s21c1
Sequence:CCGGGAGAGCTTTGAAGGTACAATCCTCGAGGATTGTACCTTCAAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152490.1-407s1c1
Sequence:CCGGGCTCGCAATAACCATGAACTTCTCGAGAAGTTCATGGTTATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152490.1-338s1c1
Sequence:CCGGGCAGATCAGTTGGCCTTATTTCTCGAGAAATAAGGCCAACTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1710s1c1
Sequence:CCGGCTTGTCGATGTCAAGCAAGATCTCGAGATCTTGCTTGACATCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1103s1c1
Sequence:CCGGCGCCCTCAAAGACTTATTGATCTCGAGATCAATAAGTCTTTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1079s1c1
Sequence:CCGGGCTCTCTTACACAACCTTCATCTCGAGATGAAGGTTGTGTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152490
VALIDATED
B3GALNT2 MISSION shRNA shRNA Plasmid DNA
beta-1,3-N-acetylgalactosaminyltransferase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1568s21c1
Sequence:CCGGATGGCTGCCATAGGACCTAAACTCGAGTTTAGGTCCTATGGCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1203s21c1
Sequence:CCGGTTGTCGACACTTATCGTAATGCTCGAGCATTACGATAAGTGTCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1348s21c1
Sequence:CCGGGAATCTGGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-878s21c1
Sequence:CCGGGAGAGCTTTGAAGGTACAATCCTCGAGGATTGTACCTTCAAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152490.1-407s1c1
Sequence:CCGGGCTCGCAATAACCATGAACTTCTCGAGAAGTTCATGGTTATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152490.1-338s1c1
Sequence:CCGGGCAGATCAGTTGGCCTTATTTCTCGAGAAATAAGGCCAACTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1710s1c1
Sequence:CCGGCTTGTCGATGTCAAGCAAGATCTCGAGATCTTGCTTGACATCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1103s1c1
Sequence:CCGGCGCCCTCAAAGACTTATTGATCTCGAGATCAATAAGTCTTTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1079s1c1
Sequence:CCGGGCTCTCTTACACAACCTTCATCTCGAGATGAAGGTTGTGTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152490
VALIDATED
B3GALNT2 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-N-acetylgalactosaminyltransferase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1568s21c1
Sequence:CCGGATGGCTGCCATAGGACCTAAACTCGAGTTTAGGTCCTATGGCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1203s21c1
Sequence:CCGGTTGTCGACACTTATCGTAATGCTCGAGCATTACGATAAGTGTCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-1348s21c1
Sequence:CCGGGAATCTGGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152490.1-878s21c1
Sequence:CCGGGAGAGCTTTGAAGGTACAATCCTCGAGGATTGTACCTTCAAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152490.1-407s1c1
Sequence:CCGGGCTCGCAATAACCATGAACTTCTCGAGAAGTTCATGGTTATTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152490.1-338s1c1
Sequence:CCGGGCAGATCAGTTGGCCTTATTTCTCGAGAAATAAGGCCAACTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1710s1c1
Sequence:CCGGCTTGTCGATGTCAAGCAAGATCTCGAGATCTTGCTTGACATCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1103s1c1
Sequence:CCGGCGCCCTCAAAGACTTATTGATCTCGAGATCAATAAGTCTTTGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152490.1-1079s1c1
Sequence:CCGGGCTCTCTTACACAACCTTCATCTCGAGATGAAGGTTGTGTAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178640
VALIDATED
B3GALNT2 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-N-acetylgalactosaminyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-3228s21c1
Sequence:CCGGATACCATTTCAGTAGCATTTACTCGAGTAAATGCTACTGAAATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-1419s21c1
Sequence:CCGGGGCAACTCCAGAAGGTTAAAGCTCGAGCTTTAACCTTCTGGAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.2-741s1c1
Sequence:CCGGGTGAACAAGCTCTGGTATAAGCTCGAGCTTATACCAGAGCTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.2-1256s1c1
Sequence:CCGGGAATCTAGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-1256s21c1
Sequence:CCGGGAATCTAGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-366s21c1
Sequence:CCGGTTGCTGCATCATCCTACATTACTCGAGTAATGTAGGATGATGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-741s21c1
Sequence:CCGGGTGAACAAGCTCTGGTATAAGCTCGAGCTTATACCAGAGCTTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178640.1-2893s1c1
Sequence:CCGGGCCTCCATTTAGAGCCTGTTACTCGAGTAACAGGCTCTAAATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.1-1120s1c1
Sequence:CCGGCTTACCGGAATGTTCCTGCAACTCGAGTTGCAGGAACATTCCGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.1-312s1c1
Sequence:CCGGGCTCGAAATAACCACGAACTTCTCGAGAAGTTCGTGGTTATTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178640
VALIDATED
B3GALNT2 MISSION shRNA shRNA Plasmid DNA
beta-1,3-N-acetylgalactosaminyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-3228s21c1
Sequence:CCGGATACCATTTCAGTAGCATTTACTCGAGTAAATGCTACTGAAATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-1419s21c1
Sequence:CCGGGGCAACTCCAGAAGGTTAAAGCTCGAGCTTTAACCTTCTGGAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.2-741s1c1
Sequence:CCGGGTGAACAAGCTCTGGTATAAGCTCGAGCTTATACCAGAGCTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.2-1256s1c1
Sequence:CCGGGAATCTAGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-1256s21c1
Sequence:CCGGGAATCTAGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-366s21c1
Sequence:CCGGTTGCTGCATCATCCTACATTACTCGAGTAATGTAGGATGATGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-741s21c1
Sequence:CCGGGTGAACAAGCTCTGGTATAAGCTCGAGCTTATACCAGAGCTTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178640.1-2893s1c1
Sequence:CCGGGCCTCCATTTAGAGCCTGTTACTCGAGTAACAGGCTCTAAATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.1-1120s1c1
Sequence:CCGGCTTACCGGAATGTTCCTGCAACTCGAGTTGCAGGAACATTCCGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.1-312s1c1
Sequence:CCGGGCTCGAAATAACCACGAACTTCTCGAGAAGTTCGTGGTTATTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178640
VALIDATED
B3GALNT2 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-N-acetylgalactosaminyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-3228s21c1
Sequence:CCGGATACCATTTCAGTAGCATTTACTCGAGTAAATGCTACTGAAATGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-1419s21c1
Sequence:CCGGGGCAACTCCAGAAGGTTAAAGCTCGAGCTTTAACCTTCTGGAGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217312    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.2-741s1c1
Sequence:CCGGGTGAACAAGCTCTGGTATAAGCTCGAGCTTATACCAGAGCTTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.2-1256s1c1
Sequence:CCGGGAATCTAGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-1256s21c1
Sequence:CCGGGAATCTAGATGGGCCTAATTTCTCGAGAAATTAGGCCCATCTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-366s21c1
Sequence:CCGGTTGCTGCATCATCCTACATTACTCGAGTAATGTAGGATGATGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178640.2-741s21c1
Sequence:CCGGGTGAACAAGCTCTGGTATAAGCTCGAGCTTATACCAGAGCTTGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178640.1-2893s1c1
Sequence:CCGGGCCTCCATTTAGAGCCTGTTACTCGAGTAACAGGCTCTAAATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.1-1120s1c1
Sequence:CCGGCTTACCGGAATGTTCCTGCAACTCGAGTTGCAGGAACATTCCGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178640.1-312s1c1
Sequence:CCGGGCTCGAAATAACCACGAACTTCTCGAGAAGTTCGTGGTTATTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks