EMAIL THIS PAGE TO A FRIEND

B3GALT1

UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1

123 Gene Product Result for
Synonyms: beta3Gal-T1
UniProtKB ID: Q9Y5Z6, D3DPB8, Q53SS2
Gene ID:
Human(8708) Summary: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
Mouse(26877) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Rat(366064) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
naked mole-rat(101712201) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
domestic guinea pig(100714162) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
sheep(101122666) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Domestic Rabbit(100338140) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
chicken(429027) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
cow(539027) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
domestic cat(101084131) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Horse(100052244) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
dog(488386) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020981 Rosetta Predictions human pricing
NM_001108954 Rosetta Predictions rat pricing
NM_020283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175176 predicted 889
2 SASI_Hs01_00175177 predicted 1289
3 SASI_Hs01_00175179 predicted 610
4 SASI_Hs01_00175180 predicted 1175
5 SASI_Hs02_00354430 predicted 1017
6 SASI_Hs01_00175181 predicted 519
7 SASI_Hs01_00175182 predicted 1227
8 SASI_Hs01_00175183 predicted 965
9 SASI_Hs02_00354431 predicted 354
10 SASI_Hs01_00175184 predicted 1242
11 SASI_Hs01_00175178 predicted 1008
12 SASI_Hs01_00175185 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243724 predicted 427
2 SASI_Rn02_00243725 predicted 1101
3 SASI_Rn02_00243726 predicted 928
4 SASI_Rn02_00243727 predicted 1220
5 SASI_Rn02_00243728 predicted 1241
6 SASI_Rn02_00243729 predicted 1003
7 SASI_Rn02_00243730 predicted 868
8 SASI_Rn02_00243731 predicted 817
9 SASI_Rn02_00243732 predicted 895
10 SASI_Rn02_00243733 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325485 predicted 369
2 SASI_Mm01_00120966 predicted 812
3 SASI_Mm01_00120967 predicted 1157
4 SASI_Mm01_00120968 predicted 1180
5 SASI_Mm01_00120969 predicted 1180
6 SASI_Mm01_00120970 predicted 867
7 SASI_Mm01_00120971 predicted 1147
8 SASI_Mm01_00120972 predicted 832
9 SASI_Mm01_00120973 predicted 330
10 SASI_Mm01_00120974 predicted 758
11 SASI_Mm01_00120975 predicted 1176
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020981
B3GALT1 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1222s1c1
Sequence:CCGGGCCTACAGTTTGTGTAGGTATCTCGAGATACCTACACAAACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-406s1c1
Sequence:CCGGGCTCTCTGGTACTTGAGTATACTCGAGTATACTCAAGTACCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1284s1c1
Sequence:CCGGGCACAGAATCTGGAATGACATCTCGAGATGTCATTCCAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1310s1c1
Sequence:CCGGGCAAGAAACATCTCAGATGTTCTCGAGAACATCTGAGATGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-938s1c1
Sequence:CCGGCCAAGCCACGAAGAAGGTATTCTCGAGAATACCTTCTTCGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020981.2-547s21c1
Sequence:CCGGCTTATCAACGAGCCCAATAAACTCGAGTTTATTGGGCTCGTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020981.2-1085s21c1
Sequence:CCGGCCGATGTAGCTGAACTCATTTCTCGAGAAATGAGTTCAGCTACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020981
B3GALT1 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1222s1c1
Sequence:CCGGGCCTACAGTTTGTGTAGGTATCTCGAGATACCTACACAAACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-406s1c1
Sequence:CCGGGCTCTCTGGTACTTGAGTATACTCGAGTATACTCAAGTACCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1284s1c1
Sequence:CCGGGCACAGAATCTGGAATGACATCTCGAGATGTCATTCCAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1310s1c1
Sequence:CCGGGCAAGAAACATCTCAGATGTTCTCGAGAACATCTGAGATGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-938s1c1
Sequence:CCGGCCAAGCCACGAAGAAGGTATTCTCGAGAATACCTTCTTCGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020981.2-547s21c1
Sequence:CCGGCTTATCAACGAGCCCAATAAACTCGAGTTTATTGGGCTCGTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020981.2-1085s21c1
Sequence:CCGGCCGATGTAGCTGAACTCATTTCTCGAGAAATGAGTTCAGCTACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020981
B3GALT1 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1222s1c1
Sequence:CCGGGCCTACAGTTTGTGTAGGTATCTCGAGATACCTACACAAACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-406s1c1
Sequence:CCGGGCTCTCTGGTACTTGAGTATACTCGAGTATACTCAAGTACCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1284s1c1
Sequence:CCGGGCACAGAATCTGGAATGACATCTCGAGATGTCATTCCAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-1310s1c1
Sequence:CCGGGCAAGAAACATCTCAGATGTTCTCGAGAACATCTGAGATGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020981.2-938s1c1
Sequence:CCGGCCAAGCCACGAAGAAGGTATTCTCGAGAATACCTTCTTCGTGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020981.2-547s21c1
Sequence:CCGGCTTATCAACGAGCCCAATAAACTCGAGTTTATTGGGCTCGTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020981.2-1085s21c1
Sequence:CCGGCCGATGTAGCTGAACTCATTTCTCGAGAAATGAGTTCAGCTACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020283
B3GALT1 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-71s1c1
Sequence:CCGGGCATAACCAGACCTACTTCATCTCGAGATGAAGTAGGTCTGGTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-666s1c1
Sequence:CCGGGCCTAGAGATTTGTACCCTGACTCGAGTCAGGGTACAAATCTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-153s1c1
Sequence:CCGGCAACATAAGAACTCGACCTATCTCGAGATAGGTCGAGTTCTTATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-588s1c1
Sequence:CCGGCAAGCCAAGAAGAAGGTATTTCTCGAGAAATACCTTCTTCTTGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-109s1c1
Sequence:CCGGCCGTTCAGTCACCTAACAGTTCTCGAGAACTGTTAGGTGACTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020283
B3GALT1 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-71s1c1
Sequence:CCGGGCATAACCAGACCTACTTCATCTCGAGATGAAGTAGGTCTGGTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-666s1c1
Sequence:CCGGGCCTAGAGATTTGTACCCTGACTCGAGTCAGGGTACAAATCTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-153s1c1
Sequence:CCGGCAACATAAGAACTCGACCTATCTCGAGATAGGTCGAGTTCTTATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-588s1c1
Sequence:CCGGCAAGCCAAGAAGAAGGTATTTCTCGAGAAATACCTTCTTCTTGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-109s1c1
Sequence:CCGGCCGTTCAGTCACCTAACAGTTCTCGAGAACTGTTAGGTGACTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020283
B3GALT1 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-71s1c1
Sequence:CCGGGCATAACCAGACCTACTTCATCTCGAGATGAAGTAGGTCTGGTTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-666s1c1
Sequence:CCGGGCCTAGAGATTTGTACCCTGACTCGAGTCAGGGTACAAATCTCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-153s1c1
Sequence:CCGGCAACATAAGAACTCGACCTATCTCGAGATAGGTCGAGTTCTTATGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-588s1c1
Sequence:CCGGCAAGCCAAGAAGAAGGTATTTCTCGAGAAATACCTTCTTCTTGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020283.1-109s1c1
Sequence:CCGGCCGTTCAGTCACCTAACAGTTCTCGAGAACTGTTAGGTGACTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks