EMAIL THIS PAGE TO A FRIEND

B3GALT2

UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2

106 Gene Product Result for
Synonyms: BETA3GALT2 GLCT2 beta3Gal-T2
UniProtKB ID: O43825, B2RAB1, Q9BZQ9
Gene ID:
Human(8707) Summary: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene encodes a protein that functions in N-linked glycoprotein glycosylation and shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
Mouse(26878) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Rat(686081) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Zebrafish(404633) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
cow(539815) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Horse(100051213) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
domestic cat(101091170) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
dog(607356) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
chicken(769122) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
sheep(101121025) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Domestic Rabbit(100348508) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
domestic guinea pig(100713957) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
naked mole-rat(101726237) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003783 Rosetta Predictions human pricing
NM_001109492 Rosetta Predictions rat pricing
NM_020025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127937 predicted 762
2 SASI_Hs01_00127938 predicted 1606
3 SASI_Hs02_00336284 predicted 761
4 SASI_Hs01_00127939 predicted 1182
5 SASI_Hs01_00127940 predicted 1260
6 SASI_Hs01_00127941 predicted 1333
7 SASI_Hs01_00127942 predicted 1396
8 SASI_Hs01_00127943 predicted 873
9 SASI_Hs01_00127945 predicted 1316
10 SASI_Hs01_00127946 predicted 1034
11 SASI_Hs01_00127944 predicted 1705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248929 predicted 1289
2 SASI_Rn02_00248930 predicted 1997
3 SASI_Rn02_00248931 predicted 1211
4 SASI_Rn02_00248932 predicted 1407
5 SASI_Rn02_00248933 predicted 1334
6 SASI_Rn02_00248934 predicted 2076
7 SASI_Rn02_00248935 predicted 1362
8 SASI_Rn02_00248936 predicted 1353
9 SASI_Rn02_00248937 predicted 1034
10 SASI_Rn02_00248938 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055553 predicted 1341
2 SASI_Mm01_00055554 predicted 1394
3 SASI_Mm01_00055561 predicted 1835
4 SASI_Mm01_00055555 predicted 1465
5 SASI_Mm01_00055556 predicted 1259
6 SASI_Mm01_00055557 predicted 2123
7 SASI_Mm01_00055558 predicted 1334
8 SASI_Mm01_00055559 predicted 1533
9 SASI_Mm01_00055560 predicted 1896
10 SASI_Mm01_00055562 predicted 2005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003783
B3GALT2 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1102s21c1
Sequence:CCGGACATCCAAATTCTTACCATTTCTCGAGAAATGGTAAGAATTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-995s21c1
Sequence:CCGGCAAACAGCAACTAACTCTAATCTCGAGATTAGAGTTAGTTGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1383s21c1
Sequence:CCGGCGTACTATAATTTGACCATTACTCGAGTAATGGTCAAATTATAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1310s21c1
Sequence:CCGGGGCTACCTTCAACGTGCAATACTCGAGTATTGCACGTTGAAGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-887s1c1
Sequence:CCGGCCGAGGATTTCGGTCAACAAACTCGAGTTTGTTGACCGAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1814s1c1
Sequence:CCGGCTGTAAATACAGCCACCTAATCTCGAGATTAGGTGGCTGTATTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1237s1c1
Sequence:CCGGCTGGTATTCAAATCACAAGAACTCGAGTTCTTGTGATTTGAATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1410s1c1
Sequence:CCGGGCAACATACTGTCCACATATTCTCGAGAATATGTGGACAGTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-765s1c1
Sequence:CCGGCGCACTCATCTTATTGGAGTACTCGAGTACTCCAATAAGATGAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003783
B3GALT2 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1102s21c1
Sequence:CCGGACATCCAAATTCTTACCATTTCTCGAGAAATGGTAAGAATTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-995s21c1
Sequence:CCGGCAAACAGCAACTAACTCTAATCTCGAGATTAGAGTTAGTTGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1383s21c1
Sequence:CCGGCGTACTATAATTTGACCATTACTCGAGTAATGGTCAAATTATAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1310s21c1
Sequence:CCGGGGCTACCTTCAACGTGCAATACTCGAGTATTGCACGTTGAAGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-887s1c1
Sequence:CCGGCCGAGGATTTCGGTCAACAAACTCGAGTTTGTTGACCGAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1814s1c1
Sequence:CCGGCTGTAAATACAGCCACCTAATCTCGAGATTAGGTGGCTGTATTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1237s1c1
Sequence:CCGGCTGGTATTCAAATCACAAGAACTCGAGTTCTTGTGATTTGAATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1410s1c1
Sequence:CCGGGCAACATACTGTCCACATATTCTCGAGAATATGTGGACAGTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-765s1c1
Sequence:CCGGCGCACTCATCTTATTGGAGTACTCGAGTACTCCAATAAGATGAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003783
B3GALT2 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1102s21c1
Sequence:CCGGACATCCAAATTCTTACCATTTCTCGAGAAATGGTAAGAATTTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-995s21c1
Sequence:CCGGCAAACAGCAACTAACTCTAATCTCGAGATTAGAGTTAGTTGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1383s21c1
Sequence:CCGGCGTACTATAATTTGACCATTACTCGAGTAATGGTCAAATTATAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003783.3-1310s21c1
Sequence:CCGGGGCTACCTTCAACGTGCAATACTCGAGTATTGCACGTTGAAGGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-887s1c1
Sequence:CCGGCCGAGGATTTCGGTCAACAAACTCGAGTTTGTTGACCGAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1814s1c1
Sequence:CCGGCTGTAAATACAGCCACCTAATCTCGAGATTAGGTGGCTGTATTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1237s1c1
Sequence:CCGGCTGGTATTCAAATCACAAGAACTCGAGTTCTTGTGATTTGAATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-1410s1c1
Sequence:CCGGGCAACATACTGTCCACATATTCTCGAGAATATGTGGACAGTATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003783.2-765s1c1
Sequence:CCGGCGCACTCATCTTATTGGAGTACTCGAGTACTCCAATAAGATGAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020025
B3GALT2 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1350s1c1
Sequence:CCGGGCAGACAGTATCATGATATAACTCGAGTTATATCATGATACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1821s1c1
Sequence:CCGGGCTGGCGAGTTTCTTATTCAACTCGAGTTGAATAAGAAACTCGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-916s1c1
Sequence:CCGGCCGAGGATTTCGTTCTACAAACTCGAGTTTGTAGAACGAAATCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1269s1c1
Sequence:CCGGGCATCCAAATCATACGGGTTTCTCGAGAAACCCGTATGATTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1694s1c1
Sequence:CCGGGCAGAGAAGATATTTAAGGTTCTCGAGAACCTTAAATATCTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020025
B3GALT2 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1350s1c1
Sequence:CCGGGCAGACAGTATCATGATATAACTCGAGTTATATCATGATACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1821s1c1
Sequence:CCGGGCTGGCGAGTTTCTTATTCAACTCGAGTTGAATAAGAAACTCGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-916s1c1
Sequence:CCGGCCGAGGATTTCGTTCTACAAACTCGAGTTTGTAGAACGAAATCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1269s1c1
Sequence:CCGGGCATCCAAATCATACGGGTTTCTCGAGAAACCCGTATGATTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1694s1c1
Sequence:CCGGGCAGAGAAGATATTTAAGGTTCTCGAGAACCTTAAATATCTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020025
B3GALT2 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1350s1c1
Sequence:CCGGGCAGACAGTATCATGATATAACTCGAGTTATATCATGATACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1821s1c1
Sequence:CCGGGCTGGCGAGTTTCTTATTCAACTCGAGTTGAATAAGAAACTCGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-916s1c1
Sequence:CCGGCCGAGGATTTCGTTCTACAAACTCGAGTTTGTAGAACGAAATCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1269s1c1
Sequence:CCGGGCATCCAAATCATACGGGTTTCTCGAGAAACCCGTATGATTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020025.2-1694s1c1
Sequence:CCGGGCAGAGAAGATATTTAAGGTTCTCGAGAACCTTAAATATCTTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks