EMAIL THIS PAGE TO A FRIEND

B3GALT4

UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4

48 Gene Product Result for
Synonyms: BETA3GALT4 GALT2 GALT4
UniProtKB ID: O96024
Gene ID:
Human(8705) Summary: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is oriented telomere to centromere in close proximity to the ribosomal protein S18 gene. The functionality of the encoded protein is limited to ganglioseries glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(54218) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Rat(171079) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
naked mole-rat(101722054) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
domestic guinea pig(100731582) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
sheep(101111585) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
dog(481737) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
cow(768038) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
domestic cat(101087480) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041311 MISSION® esiRNA esiRNA targeting mouse B3galt4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003782 Rosetta Predictions human pricing
NM_133553 Rosetta Predictions rat pricing
NM_019420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099681 predicted 589
2 SASI_Hs01_00099682 predicted 1131
3 SASI_Hs01_00099683 predicted 1371
4 SASI_Hs01_00099685 predicted 287
5 SASI_Hs01_00099686 predicted 589
6 SASI_Hs01_00099687 predicted 1094
7 SASI_Hs01_00099688 predicted 1223
8 SASI_Hs01_00099689 predicted 592
9 SASI_Hs01_00099690 predicted 813
10 SASI_Hs02_00336283 predicted 310
11 SASI_Hs01_00099684 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070033 predicted 1122
2 SASI_Rn01_00070035 predicted 527
3 SASI_Rn01_00070036 predicted 235
4 SASI_Rn01_00070037 predicted 676
5 SASI_Rn01_00070038 predicted 1251
6 SASI_Rn01_00070039 predicted 967
7 SASI_Rn02_00267742 predicted 694
8 SASI_Rn01_00070040 predicted 795
9 SASI_Rn01_00070041 predicted 803
10 SASI_Rn01_00070042 predicted 254
11 SASI_Rn01_00070034 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045944 predicted 718
2 SASI_Mm01_00045945 predicted 1158
3 SASI_Mm01_00045946 predicted 384
4 SASI_Mm01_00045947 predicted 722
5 SASI_Mm01_00045948 predicted 528
6 SASI_Mm01_00045949 predicted 939
7 SASI_Mm01_00045950 predicted 1288
8 SASI_Mm01_00045951 predicted 658
9 SASI_Mm01_00045952 predicted 705
10 SASI_Mm02_00324344 predicted 266
11 SASI_Mm01_00045953 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003782
VALIDATED
B3GALT4 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003782.2-1110s1c1
Sequence:CCGGCTCCCATTAGAGGATGTCTTTCTCGAGAAAGACATCCTCTAATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003782.2-560s1c1
Sequence:CCGGCAGGGTACAGACGCTATTCTTCTCGAGAAGAATAGCGTCTGTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-501s1c1
Sequence:CCGGCTGAACCAGAGAAACGCCATTCTCGAGAATGGCGTTTCTCTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-772s1c1
Sequence:CCGGCGGACGATGATGTGTATGTCACTCGAGTGACATACACATCATCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-1359s1c1
Sequence:CCGGTGTCGAGCAATAGCCTGGCTTCTCGAGAAGCCAGGCTATTGCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-587s21c1
Sequence:CCGGCTCAGGGTACAGACGCTATTCCTCGAGGAATAGCGTCTGTACCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-719s21c1
Sequence:CCGGTACCGCAACCTCACCCTAAAGCTCGAGCTTTAGGGTGAGGTTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-1379s21c1
Sequence:CCGGATCCTGCGGTGTCGAGCAATACTCGAGTATTGCTCGACACCGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003782.3-1528s21c1
Sequence:CCGGTCTCACTAAAGACAGCGATATCTCGAGATATCGCTGTCTTTAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-1239s21c1
Sequence:CCGGACCGGTGCTGCTATGGGAAATCTCGAGATTTCCCATAGCAGCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003782
VALIDATED
B3GALT4 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003782.2-1110s1c1
Sequence:CCGGCTCCCATTAGAGGATGTCTTTCTCGAGAAAGACATCCTCTAATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003782.2-560s1c1
Sequence:CCGGCAGGGTACAGACGCTATTCTTCTCGAGAAGAATAGCGTCTGTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-501s1c1
Sequence:CCGGCTGAACCAGAGAAACGCCATTCTCGAGAATGGCGTTTCTCTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-772s1c1
Sequence:CCGGCGGACGATGATGTGTATGTCACTCGAGTGACATACACATCATCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-1359s1c1
Sequence:CCGGTGTCGAGCAATAGCCTGGCTTCTCGAGAAGCCAGGCTATTGCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-587s21c1
Sequence:CCGGCTCAGGGTACAGACGCTATTCCTCGAGGAATAGCGTCTGTACCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-719s21c1
Sequence:CCGGTACCGCAACCTCACCCTAAAGCTCGAGCTTTAGGGTGAGGTTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-1379s21c1
Sequence:CCGGATCCTGCGGTGTCGAGCAATACTCGAGTATTGCTCGACACCGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003782.3-1528s21c1
Sequence:CCGGTCTCACTAAAGACAGCGATATCTCGAGATATCGCTGTCTTTAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-1239s21c1
Sequence:CCGGACCGGTGCTGCTATGGGAAATCTCGAGATTTCCCATAGCAGCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003782
VALIDATED
B3GALT4 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_003782.2-1110s1c1
Sequence:CCGGCTCCCATTAGAGGATGTCTTTCTCGAGAAAGACATCCTCTAATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003782.2-560s1c1
Sequence:CCGGCAGGGTACAGACGCTATTCTTCTCGAGAAGAATAGCGTCTGTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-501s1c1
Sequence:CCGGCTGAACCAGAGAAACGCCATTCTCGAGAATGGCGTTTCTCTGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-772s1c1
Sequence:CCGGCGGACGATGATGTGTATGTCACTCGAGTGACATACACATCATCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003782.2-1359s1c1
Sequence:CCGGTGTCGAGCAATAGCCTGGCTTCTCGAGAAGCCAGGCTATTGCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-587s21c1
Sequence:CCGGCTCAGGGTACAGACGCTATTCCTCGAGGAATAGCGTCTGTACCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-719s21c1
Sequence:CCGGTACCGCAACCTCACCCTAAAGCTCGAGCTTTAGGGTGAGGTTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-1379s21c1
Sequence:CCGGATCCTGCGGTGTCGAGCAATACTCGAGTATTGCTCGACACCGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003782.3-1528s21c1
Sequence:CCGGTCTCACTAAAGACAGCGATATCTCGAGATATCGCTGTCTTTAGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003782.3-1239s21c1
Sequence:CCGGACCGGTGCTGCTATGGGAAATCTCGAGATTTCCCATAGCAGCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019420
B3GALT4 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019420.1-1401s1c1
Sequence:CCGGGTGGTGATCTAGTTCCTCCATCTCGAGATGGAGGAACTAGATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-1121s1c1
Sequence:CCGGGTGTCAAATTGGCTGGTGCTACTCGAGTAGCACCAGCCAATTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-816s1c1
Sequence:CCGGCCAGGAAGAGACAACAGCTATCTCGAGATAGCTGTTGTCTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-385s1c1
Sequence:CCGGCTCTTGATTTCTAACTCTCATCTCGAGATGAGAGTTAGAAATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-989s1c1
Sequence:CCGGGCACAGGATATGTACTGTCCACTCGAGTGGACAGTACATATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019420
B3GALT4 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019420.1-1401s1c1
Sequence:CCGGGTGGTGATCTAGTTCCTCCATCTCGAGATGGAGGAACTAGATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-1121s1c1
Sequence:CCGGGTGTCAAATTGGCTGGTGCTACTCGAGTAGCACCAGCCAATTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-816s1c1
Sequence:CCGGCCAGGAAGAGACAACAGCTATCTCGAGATAGCTGTTGTCTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-385s1c1
Sequence:CCGGCTCTTGATTTCTAACTCTCATCTCGAGATGAGAGTTAGAAATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-989s1c1
Sequence:CCGGGCACAGGATATGTACTGTCCACTCGAGTGGACAGTACATATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019420
B3GALT4 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019420.1-1401s1c1
Sequence:CCGGGTGGTGATCTAGTTCCTCCATCTCGAGATGGAGGAACTAGATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-1121s1c1
Sequence:CCGGGTGTCAAATTGGCTGGTGCTACTCGAGTAGCACCAGCCAATTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-816s1c1
Sequence:CCGGCCAGGAAGAGACAACAGCTATCTCGAGATAGCTGTTGTCTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-385s1c1
Sequence:CCGGCTCTTGATTTCTAACTCTCATCTCGAGATGAGAGTTAGAAATCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019420.1-989s1c1
Sequence:CCGGGCACAGGATATGTACTGTCCACTCGAGTGGACAGTACATATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks