EMAIL THIS PAGE TO A FRIEND

B3GALT5

UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5

116 Gene Product Result for
Synonyms: B3GalT-V B3GalTx B3T5 GLCT5 beta-1,3-GalTase 5 beta-3-Gx-T5 beta3Gal-T5
Gene ID:
Human(10317) Summary: This gene encodes a member of a family of membrane-bound glycoproteins. The encoded protein may synthesize type 1 Lewis antigens, which are elevated in gastrointestinal and pancreatic cancers. Alternatively spliced transcript variants have been observed for this gene, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2013]
Mouse(93961) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Rat(288161) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
chicken(427985) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
cow(614873) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
dog(487766) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
domestic cat(101098248) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
sheep(101118412) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
domestic guinea pig(100735714) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
naked mole-rat(101711866) UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003661 MISSION® esiRNA esiRNA targeting human B3GALT5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006057 Rosetta Predictions human pricing
NM_033170 Rosetta Predictions human pricing
NM_033171 Rosetta Predictions human pricing
NM_033172 Rosetta Predictions human pricing
NM_033173 Rosetta Predictions human pricing
NM_001105887 Rosetta Predictions rat pricing
NM_001122993 Rosetta Predictions mouse pricing
NM_033149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035015 predicted 922
2 SASI_Hs01_00035016 predicted 1020
3 SASI_Hs01_00035017 predicted 1100
4 SASI_Hs01_00035018 predicted 1137
5 SASI_Hs01_00035020 predicted 896
6 SASI_Hs01_00035021 predicted 1179
7 SASI_Hs01_00035022 predicted 1056
8 SASI_Hs01_00035023 predicted 892
9 SASI_Hs01_00035024 predicted 1008
10 SASI_Hs02_00340814 predicted 1127
11 SASI_Hs01_00035019 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045209 predicted 788
2 SASI_Hs02_00360915 predicted 883
3 SASI_Hs01_00045211 predicted 976
4 SASI_Hs01_00045212 predicted 1002
5 SASI_Hs02_00360916 predicted 767
6 SASI_Hs01_00045214 predicted 1053
7 SASI_Hs02_00360917 predicted 929
8 SASI_Hs01_00045215 predicted 762
9 SASI_Hs02_00360918 predicted 873
10 SASI_Hs02_00360919 predicted 996
11 SASI_Hs01_00045210 predicted 1250
12 SASI_Hs01_00045213 predicted 1180
13 SASI_Hs01_00045216 predicted 894
14 SASI_Hs01_00045217 predicted 771
15 SASI_Hs01_00045218 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201637 predicted 1029
2 SASI_Hs02_00360920 predicted 1484
3 SASI_Hs01_00201639 predicted 1212
4 SASI_Hs01_00201640 predicted 1249
5 SASI_Hs01_00201643 predicted 1295
6 SASI_Hs01_00201645 predicted 1002
7 SASI_Hs02_00360921 predicted 1007
8 SASI_Hs02_00360922 predicted 1234
9 SASI_Hs02_00360923 predicted 1234
10 SASI_Hs02_00360924 predicted 1233
11 SASI_Hs01_00201638 predicted 1132
12 SASI_Hs01_00201641 predicted 1420
13 SASI_Hs01_00201642 predicted 1013
14 SASI_Hs01_00201644 predicted 1174
15 SASI_Hs01_00201646 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076812 predicted 871
2 SASI_Hs02_00360925 predicted 963
3 SASI_Hs01_00076814 predicted 1051
4 SASI_Hs01_00076815 predicted 1089
5 SASI_Hs02_00360926 predicted 846
6 SASI_Hs01_00076817 predicted 1129
7 SASI_Hs02_00360927 predicted 1010
8 SASI_Hs01_00076818 predicted 836
9 SASI_Hs02_00360928 predicted 951
10 SASI_Hs02_00360929 predicted 1075
11 SASI_Hs01_00076813 predicted 1329
12 SASI_Hs01_00076816 predicted 1260
13 SASI_Hs01_00076819 predicted 979
14 SASI_Hs01_00076820 predicted 849
15 SASI_Hs01_00076821 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141752 predicted 1571
2 SASI_Hs01_00141753 predicted 2027
3 SASI_Hs01_00141754 predicted 1756
4 SASI_Hs01_00141755 predicted 1781
5 SASI_Hs01_00141757 predicted 1827
6 SASI_Hs01_00141758 predicted 1538
7 SASI_Hs01_00141760 predicted 1539
8 SASI_Hs02_00360930 predicted 1774
9 SASI_Hs02_00360931 predicted 1771
10 SASI_Hs02_00360932 predicted 1771
11 SASI_Hs01_00141756 predicted 1956
12 SASI_Hs01_00141759 predicted 1671
13 SASI_Hs01_00141761 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213512 predicted 1159
2 SASI_Rn02_00213513 predicted 1547
3 SASI_Rn02_00213514 predicted 1755
4 SASI_Rn02_00213515 predicted 972
5 SASI_Rn02_00213516 predicted 941
6 SASI_Rn02_00213517 predicted 1055
7 SASI_Rn02_00213518 predicted 990
8 SASI_Rn02_00213519 predicted 1689
9 SASI_Rn02_00213520 predicted 954
10 SASI_Rn02_00213521 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309749 predicted 1170
2 SASI_Mm02_00309750 predicted 1545
3 SASI_Mm02_00309751 predicted 720
4 SASI_Mm02_00309752 predicted 646
5 SASI_Mm02_00309753 predicted 1047
6 SASI_Mm02_00309754 predicted 988
7 SASI_Mm02_00309755 predicted 1061
8 SASI_Mm02_00309756 predicted 828
9 SASI_Mm02_00309757 predicted 1061
10 SASI_Mm02_00309758 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043360 predicted 804
2 SASI_Mm02_00337302 predicted 1181
3 SASI_Mm02_00337303 predicted 358
4 SASI_Mm01_00043362 predicted 274
5 SASI_Mm01_00043364 predicted 680
6 SASI_Mm01_00043365 predicted 627
7 SASI_Mm02_00337304 predicted 692
8 SASI_Mm01_00043366 predicted 459
9 SASI_Mm01_00043367 predicted 691
10 SASI_Mm01_00043368 predicted 808
11 SASI_Mm01_00043361 predicted 569
12 SASI_Mm01_00043363 predicted 619
13 SASI_Mm01_00043369 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033170
B3GALT5 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033170.1-1245s21c1
Sequence:CCGGAGGCACATCCGGACAAGTTTCCTCGAGGAAACTTGTCCGGATGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033170.1-665s21c1
Sequence:CCGGAGGATTTCCTAGACGTCTATTCTCGAGAATAGACGTCTAGGAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-887s1c1
Sequence:CCGGGCAAGTGGTTTGTCAGTAAATCTCGAGATTTACTGACAAACCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-1006s1c1
Sequence:CCGGGTCCCATACATTAAACTGGAACTCGAGTTCCAGTTTAATGTATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-388s1c1
Sequence:CCGGCCTTTCAAAGAACAGTCCTTTCTCGAGAAAGGACTGTTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-400s1c1
Sequence:CCGGCAGTCCTTTGTTTACAAGAAACTCGAGTTTCTTGTAAACAAAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-1050s1c1
Sequence:CCGGCGAAAGGCTGAACATCAGATTCTCGAGAATCTGATGTTCAGCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033170
B3GALT5 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033170.1-1245s21c1
Sequence:CCGGAGGCACATCCGGACAAGTTTCCTCGAGGAAACTTGTCCGGATGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033170.1-665s21c1
Sequence:CCGGAGGATTTCCTAGACGTCTATTCTCGAGAATAGACGTCTAGGAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-887s1c1
Sequence:CCGGGCAAGTGGTTTGTCAGTAAATCTCGAGATTTACTGACAAACCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-1006s1c1
Sequence:CCGGGTCCCATACATTAAACTGGAACTCGAGTTCCAGTTTAATGTATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-388s1c1
Sequence:CCGGCCTTTCAAAGAACAGTCCTTTCTCGAGAAAGGACTGTTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-400s1c1
Sequence:CCGGCAGTCCTTTGTTTACAAGAAACTCGAGTTTCTTGTAAACAAAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-1050s1c1
Sequence:CCGGCGAAAGGCTGAACATCAGATTCTCGAGAATCTGATGTTCAGCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033170
B3GALT5 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033170.1-1245s21c1
Sequence:CCGGAGGCACATCCGGACAAGTTTCCTCGAGGAAACTTGTCCGGATGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033170.1-665s21c1
Sequence:CCGGAGGATTTCCTAGACGTCTATTCTCGAGAATAGACGTCTAGGAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-887s1c1
Sequence:CCGGGCAAGTGGTTTGTCAGTAAATCTCGAGATTTACTGACAAACCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-1006s1c1
Sequence:CCGGGTCCCATACATTAAACTGGAACTCGAGTTCCAGTTTAATGTATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-388s1c1
Sequence:CCGGCCTTTCAAAGAACAGTCCTTTCTCGAGAAAGGACTGTTCTTTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-400s1c1
Sequence:CCGGCAGTCCTTTGTTTACAAGAAACTCGAGTTTCTTGTAAACAAAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033170.1-1050s1c1
Sequence:CCGGCGAAAGGCTGAACATCAGATTCTCGAGAATCTGATGTTCAGCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033149
B3GALT5 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-794s1c1
Sequence:CCGGGCAGAAGTTCAACAAGTGGTTCTCGAGAACCACTTGTTGAACTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-1110s1c1
Sequence:CCGGGCACTGGAGAACTCGAAAGAACTCGAGTTCTTTCGAGTTCTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-998s1c1
Sequence:CCGGGCACACCAAACAGACCTTCTTCTCGAGAAGAAGGTCTGTTTGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-660s1c1
Sequence:CCGGCAGACAGCTTACGTGATGAAACTCGAGTTTCATCACGTAAGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-339s1c1
Sequence:CCGGCACGGGAAGTTCCTTCAGATTCTCGAGAATCTGAAGGAACTTCCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033149
B3GALT5 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-794s1c1
Sequence:CCGGGCAGAAGTTCAACAAGTGGTTCTCGAGAACCACTTGTTGAACTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-1110s1c1
Sequence:CCGGGCACTGGAGAACTCGAAAGAACTCGAGTTCTTTCGAGTTCTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-998s1c1
Sequence:CCGGGCACACCAAACAGACCTTCTTCTCGAGAAGAAGGTCTGTTTGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-660s1c1
Sequence:CCGGCAGACAGCTTACGTGATGAAACTCGAGTTTCATCACGTAAGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-339s1c1
Sequence:CCGGCACGGGAAGTTCCTTCAGATTCTCGAGAATCTGAAGGAACTTCCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033149
B3GALT5 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-794s1c1
Sequence:CCGGGCAGAAGTTCAACAAGTGGTTCTCGAGAACCACTTGTTGAACTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-1110s1c1
Sequence:CCGGGCACTGGAGAACTCGAAAGAACTCGAGTTCTTTCGAGTTCTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-998s1c1
Sequence:CCGGGCACACCAAACAGACCTTCTTCTCGAGAAGAAGGTCTGTTTGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-660s1c1
Sequence:CCGGCAGACAGCTTACGTGATGAAACTCGAGTTTCATCACGTAAGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033149.2-339s1c1
Sequence:CCGGCACGGGAAGTTCCTTCAGATTCTCGAGAATCTGAAGGAACTTCCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks