EMAIL THIS PAGE TO A FRIEND

B3GALT6

UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6

43 Gene Product Result for
Synonyms: EDSP2 SEMDJL1 beta3GalT6
UniProtKB ID: Q96L58, Q5T7M5
Gene ID:
Human(126792) Summary: The enzyme encoded by this intronless gene is a beta-1,3-galactosyltransferase found in the medial Golgi apparatus, where it catalyzes the transfer of galactose from UDP-galactose to substrates containing a terminal beta-linked galactose moiety. The encoded enzyme has a particular affinity for galactose-beta-1,4-xylose found in the linker region of glycosamines. This enzyme is required for glycosaminoglycan synthesis. [provided by RefSeq, Jun 2013]
Mouse(117592) UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6
Rat(298690) UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6
naked mole-rat(101721217) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
domestic guinea pig(100730778) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
sheep(101105768) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Zebrafish(572324) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
chicken(428185) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
cow(522406) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
dog(664717) UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50258 Anti-B3GALT6 (AB1) antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, mouse, rat, zebrafish
western blot pricing
AV50259 Anti-B3GALT6 (AB2) antibody produced in rabbit affinity isolated antibody zebrafish, horse, rat, human, mouse, guinea pig, canine
western blot pricing
WH0126792M6 Monoclonal Anti-B3GALT6 antibody produced in mouse clone 3E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080605 Rosetta Predictions human pricing
NM_001106699 Rosetta Predictions rat pricing
NM_080445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014795 predicted 1421
2 SASI_Hs01_00014796 predicted 1341
3 SASI_Hs01_00014797 predicted 1460
4 SASI_Hs01_00014798 predicted 1358
5 SASI_Hs02_00362343 predicted 1402
6 SASI_Hs01_00014794 predicted 1438
7 SASI_Hs01_00014800 predicted 1392
8 SASI_Hs01_00014801 predicted 1398
9 SASI_Hs01_00014802 predicted 1396
10 SASI_Hs01_00014799 predicted 1428
11 SASI_Hs01_00014803 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221518 predicted 1452
2 SASI_Rn02_00221519 predicted 1156
3 SASI_Rn02_00221520 predicted 1385
4 SASI_Rn02_00221521 predicted 1053
5 SASI_Rn02_00221522 predicted 839
6 SASI_Rn02_00221523 predicted 768
7 SASI_Rn02_00221524 predicted 797
8 SASI_Rn02_00221525 predicted 1352
9 SASI_Rn02_00221526 predicted 946
10 SASI_Rn02_00221527 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102645 predicted 959
2 SASI_Mm01_00102646 predicted 829
3 SASI_Mm01_00102647 predicted 634
4 SASI_Mm01_00102648 predicted 800
5 SASI_Mm01_00102649 predicted 974
6 SASI_Mm01_00102650 predicted 486
7 SASI_Mm01_00102651 predicted 824
8 SASI_Mm01_00102652 predicted 1510
9 SASI_Mm01_00102653 predicted 862
10 SASI_Mm01_00102654 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080605
B3GALT6 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-620s1c1
Sequence:CCGGCTGGCAACTCTGCGACTACTACTCGAGTAGTAGTCGCAGAGTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-232s1c1
Sequence:CCGGGCAGCGTGATCCGCAGCACGTCTCGAGACGTGCTGCGGATCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-821s1c1
Sequence:CCGGCGGCTGCAGCAACCAGTACCTCTCGAGAGGTACTGGTTGCTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-385s1c1
Sequence:CCGGCGCTGCGCGACGCCTACGAAACTCGAGTTTCGTAGGCGTCGCGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-929s1c1
Sequence:CCGGGCTGCGCCTGTCCTACGTGTACTCGAGTACACGTAGGACAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1426s21c1
Sequence:CCGGCAGTGTTTGCTTGCGACTTATCTCGAGATAAGTCGCAAGCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1398s21c1
Sequence:CCGGGTCCAGTGACTTCGTGGTAAACTCGAGTTTACCACGAAGTCACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080605.3-473s21c1
Sequence:CCGGCCTTCGAGTTCGTGCTCAAGGCTCGAGCCTTGAGCACGAACTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080605.3-849s21c1
Sequence:CCGGCCAGTACCTGGTGACGCACAACTCGAGTTGTGCGTCACCAGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1353s21c1
Sequence:CCGGTAACGTGGTTTCACATCAATCCTCGAGGATTGATGTGAAACCACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080605
B3GALT6 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-620s1c1
Sequence:CCGGCTGGCAACTCTGCGACTACTACTCGAGTAGTAGTCGCAGAGTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-232s1c1
Sequence:CCGGGCAGCGTGATCCGCAGCACGTCTCGAGACGTGCTGCGGATCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-821s1c1
Sequence:CCGGCGGCTGCAGCAACCAGTACCTCTCGAGAGGTACTGGTTGCTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-385s1c1
Sequence:CCGGCGCTGCGCGACGCCTACGAAACTCGAGTTTCGTAGGCGTCGCGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-929s1c1
Sequence:CCGGGCTGCGCCTGTCCTACGTGTACTCGAGTACACGTAGGACAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1426s21c1
Sequence:CCGGCAGTGTTTGCTTGCGACTTATCTCGAGATAAGTCGCAAGCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1398s21c1
Sequence:CCGGGTCCAGTGACTTCGTGGTAAACTCGAGTTTACCACGAAGTCACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080605.3-473s21c1
Sequence:CCGGCCTTCGAGTTCGTGCTCAAGGCTCGAGCCTTGAGCACGAACTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080605.3-849s21c1
Sequence:CCGGCCAGTACCTGGTGACGCACAACTCGAGTTGTGCGTCACCAGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1353s21c1
Sequence:CCGGTAACGTGGTTTCACATCAATCCTCGAGGATTGATGTGAAACCACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080605
B3GALT6 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-620s1c1
Sequence:CCGGCTGGCAACTCTGCGACTACTACTCGAGTAGTAGTCGCAGAGTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-232s1c1
Sequence:CCGGGCAGCGTGATCCGCAGCACGTCTCGAGACGTGCTGCGGATCACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-821s1c1
Sequence:CCGGCGGCTGCAGCAACCAGTACCTCTCGAGAGGTACTGGTTGCTGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-385s1c1
Sequence:CCGGCGCTGCGCGACGCCTACGAAACTCGAGTTTCGTAGGCGTCGCGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080605.2-929s1c1
Sequence:CCGGGCTGCGCCTGTCCTACGTGTACTCGAGTACACGTAGGACAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1426s21c1
Sequence:CCGGCAGTGTTTGCTTGCGACTTATCTCGAGATAAGTCGCAAGCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1398s21c1
Sequence:CCGGGTCCAGTGACTTCGTGGTAAACTCGAGTTTACCACGAAGTCACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080605.3-473s21c1
Sequence:CCGGCCTTCGAGTTCGTGCTCAAGGCTCGAGCCTTGAGCACGAACTCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080605.3-849s21c1
Sequence:CCGGCCAGTACCTGGTGACGCACAACTCGAGTTGTGCGTCACCAGGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080605.3-1353s21c1
Sequence:CCGGTAACGTGGTTTCACATCAATCCTCGAGGATTGATGTGAAACCACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080445
B3GALT6 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-889s1c1
Sequence:CCGGGCAACAGATGTTGCTGCATGACTCGAGTCATGCAGCAACATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-97s1c1
Sequence:CCGGCTGCGGCACCACTCTGTTGTACTCGAGTACAACAGAGTGGTGCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-803s1c1
Sequence:CCGGCGCTTCGACACGGAGTACAAACTCGAGTTTGTACTCCGTGTCGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-937s1c1
Sequence:CCGGGTTGCGCCTTTCCTATGTCTACTCGAGTAGACATAGGAAAGGCGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-827s1c1
Sequence:CCGGCGAGGCTGCAACAATCAGTATCTCGAGATACTGATTGTTGCAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080445
B3GALT6 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-889s1c1
Sequence:CCGGGCAACAGATGTTGCTGCATGACTCGAGTCATGCAGCAACATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-97s1c1
Sequence:CCGGCTGCGGCACCACTCTGTTGTACTCGAGTACAACAGAGTGGTGCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-803s1c1
Sequence:CCGGCGCTTCGACACGGAGTACAAACTCGAGTTTGTACTCCGTGTCGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-937s1c1
Sequence:CCGGGTTGCGCCTTTCCTATGTCTACTCGAGTAGACATAGGAAAGGCGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-827s1c1
Sequence:CCGGCGAGGCTGCAACAATCAGTATCTCGAGATACTGATTGTTGCAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080445
B3GALT6 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-889s1c1
Sequence:CCGGGCAACAGATGTTGCTGCATGACTCGAGTCATGCAGCAACATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-97s1c1
Sequence:CCGGCTGCGGCACCACTCTGTTGTACTCGAGTACAACAGAGTGGTGCCGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-803s1c1
Sequence:CCGGCGCTTCGACACGGAGTACAAACTCGAGTTTGTACTCCGTGTCGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-937s1c1
Sequence:CCGGGTTGCGCCTTTCCTATGTCTACTCGAGTAGACATAGGAAAGGCGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080445.2-827s1c1
Sequence:CCGGCGAGGCTGCAACAATCAGTATCTCGAGATACTGATTGTTGCAGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks