EMAIL THIS PAGE TO A FRIEND

B3GALTL

beta 1,3-galactosyltransferase-like

124 Gene Product Result for
Synonyms: B3GLCT B3GTL B3Glc-T Gal-T beta3Glc-T
UniProtKB ID: Q6Y288, A8K5F8, Q5W0H2, Q6NUI3
Gene ID:
Human(145173) Summary: The protein encoded by this gene is a beta-1,3-glucosyltransferase that transfers glucose to O-linked fucosylglycans on thrombospondin type-1 repeats (TSRs) of several proteins. The encoded protein is a type II membrane protein. Defects in this gene are a cause of Peters-plus syndrome (PPS).[provided by RefSeq, Mar 2009]
Mouse(381694) beta 1,3-galactosyltransferase-like
Rat(689765) beta 1,3-galactosyltransferase-like
chicken(428075) beta 1,3-galactosyltransferase-like
domestic cat(101081856) beta 1,3-galactosyltransferase-like
cow(509511) beta 1,3-galactosyltransferase-like
Horse(100064175) beta 1,3-galactosyltransferase-like
dog(486017) beta 1,3-galactosyltransferase-like
sheep(101111560) beta 1,3-galactosyltransferase-like
domestic guinea pig(100735407) beta 1,3-galactosyltransferase-like
naked mole-rat(101702442) beta 1,3-galactosyltransferase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194318 Rosetta Predictions human pricing
XM_001071932 Rosetta Predictions rat pricing
NM_001081204 Rosetta Predictions mouse pricing
XM_355669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182751 predicted 1465
2 SASI_Hs01_00182752 predicted 1327
3 SASI_Hs01_00182754 predicted 726
4 SASI_Hs01_00182756 predicted 735
5 SASI_Hs02_00371456 predicted 953
6 SASI_Hs01_00182757 predicted 993
7 SASI_Hs02_00371457 predicted 1066
8 SASI_Hs01_00182759 predicted 1130
9 SASI_Hs02_00371458 predicted 822
10 SASI_Hs02_00371459 predicted 1386
11 SASI_Hs01_00182750 predicted 929
12 SASI_Hs01_00182753 predicted 1092
13 SASI_Hs01_00182755 predicted 874
14 SASI_Hs01_00182758 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337046 predicted 553
2 SASI_Rn02_00337047 predicted 308
3 SASI_Rn02_00337048 predicted 442
4 SASI_Rn02_00337049 predicted 1209
5 SASI_Rn02_00337050 predicted 541
6 SASI_Rn02_00337051 predicted 937
7 SASI_Rn02_00337052 predicted 1033
8 SASI_Rn02_00337053 predicted 844
9 SASI_Rn02_00337054 predicted 668
10 SASI_Rn02_00337055 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296211 predicted 940
2 SASI_Mm02_00296212 predicted 873
3 SASI_Mm02_00296213 predicted 1574
4 SASI_Mm02_00296214 predicted 1083
5 SASI_Mm02_00296215 predicted 678
6 SASI_Mm02_00296216 predicted 896
7 SASI_Mm02_00296217 predicted 574
8 SASI_Mm02_00296218 predicted 707
9 SASI_Mm02_00296219 predicted 1412
10 SASI_Mm02_00296220 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265489 predicted 949
2 SASI_Mm01_00265490 predicted 882
3 SASI_Mm01_00265491 predicted 1580
4 SASI_Mm01_00265492 predicted 1096
5 SASI_Mm01_00265493 predicted 690
6 SASI_Mm01_00265494 predicted 898
7 SASI_Mm01_00265495 predicted 580
8 SASI_Mm01_00265496 predicted 708
9 SASI_Mm01_00265497 predicted 1416
10 SASI_Mm01_00265498 predicted 1583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194318
B3GALTL MISSION shRNA Bacterial Glycerol Stock
beta 1,3-galactosyltransferase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-683s21c1
Sequence:CCGGCTTAAGTATTCCACTTGTAAACTCGAGTTTACAAGTGGAATACTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-849s21c1
Sequence:CCGGTTCTACTGTGCTACCACATTCCTCGAGGAATGTGGTAGCACAGTAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-440s21c1
Sequence:CCGGACTTCCGTTGTTACCGCATTTCTCGAGAAATGCGGTAACAACGGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194318.3-1991s21c1
Sequence:CCGGGACTGTCTACAGTTCTATTTGCTCGAGCAAATAGAACTGTAGACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-742s21c1
Sequence:CCGGCCGACTTTACAATAGATTTAACTCGAGTTAAATCTATTGTAAAGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-877s1c1
Sequence:CCGGCCAGTGAAGAAGAAGGATATTCTCGAGAATATCCTTCTTCTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-1311s1c1
Sequence:CCGGCGCCAGTAAATGTCGATGCTACTCGAGTAGCATCGACATTTACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-968s1c1
Sequence:CCGGGCCAGGCAAGTCTCATTGAATCTCGAGATTCAATGAGACTTGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-1117s1c1
Sequence:CCGGGCATGGTTAGTCATTGTGGATCTCGAGATCCACAATGACTAACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-276s1c1
Sequence:CCGGCCAGAGTCAAAGTAATTCTTTCTCGAGAAAGAATTACTTTGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194318
B3GALTL MISSION shRNA shRNA Plasmid DNA
beta 1,3-galactosyltransferase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-683s21c1
Sequence:CCGGCTTAAGTATTCCACTTGTAAACTCGAGTTTACAAGTGGAATACTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-849s21c1
Sequence:CCGGTTCTACTGTGCTACCACATTCCTCGAGGAATGTGGTAGCACAGTAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-440s21c1
Sequence:CCGGACTTCCGTTGTTACCGCATTTCTCGAGAAATGCGGTAACAACGGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194318.3-1991s21c1
Sequence:CCGGGACTGTCTACAGTTCTATTTGCTCGAGCAAATAGAACTGTAGACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-742s21c1
Sequence:CCGGCCGACTTTACAATAGATTTAACTCGAGTTAAATCTATTGTAAAGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-877s1c1
Sequence:CCGGCCAGTGAAGAAGAAGGATATTCTCGAGAATATCCTTCTTCTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-1311s1c1
Sequence:CCGGCGCCAGTAAATGTCGATGCTACTCGAGTAGCATCGACATTTACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-968s1c1
Sequence:CCGGGCCAGGCAAGTCTCATTGAATCTCGAGATTCAATGAGACTTGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-1117s1c1
Sequence:CCGGGCATGGTTAGTCATTGTGGATCTCGAGATCCACAATGACTAACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-276s1c1
Sequence:CCGGCCAGAGTCAAAGTAATTCTTTCTCGAGAAAGAATTACTTTGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194318
B3GALTL MISSION shRNA Lentiviral Transduction Particles
beta 1,3-galactosyltransferase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-683s21c1
Sequence:CCGGCTTAAGTATTCCACTTGTAAACTCGAGTTTACAAGTGGAATACTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-849s21c1
Sequence:CCGGTTCTACTGTGCTACCACATTCCTCGAGGAATGTGGTAGCACAGTAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-440s21c1
Sequence:CCGGACTTCCGTTGTTACCGCATTTCTCGAGAAATGCGGTAACAACGGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194318.3-1991s21c1
Sequence:CCGGGACTGTCTACAGTTCTATTTGCTCGAGCAAATAGAACTGTAGACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194318.3-742s21c1
Sequence:CCGGCCGACTTTACAATAGATTTAACTCGAGTTAAATCTATTGTAAAGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-877s1c1
Sequence:CCGGCCAGTGAAGAAGAAGGATATTCTCGAGAATATCCTTCTTCTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-1311s1c1
Sequence:CCGGCGCCAGTAAATGTCGATGCTACTCGAGTAGCATCGACATTTACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-968s1c1
Sequence:CCGGGCCAGGCAAGTCTCATTGAATCTCGAGATTCAATGAGACTTGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-1117s1c1
Sequence:CCGGGCATGGTTAGTCATTGTGGATCTCGAGATCCACAATGACTAACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194318.2-276s1c1
Sequence:CCGGCCAGAGTCAAAGTAATTCTTTCTCGAGAAAGAATTACTTTGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081204
B3GALTL MISSION shRNA Bacterial Glycerol Stock
beta 1,3-galactosyltransferase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-480s21c1
Sequence:CCGGCTAGACACACTCAGACGATATCTCGAGATATCGTCTGAGTGTGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-199s21c1
Sequence:CCGGGGAGACATGACATAGACTTAACTCGAGTTAAGTCTATGTCATGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-1419s21c1
Sequence:CCGGCATCAGATTCCAGTATCATTTCTCGAGAAATGATACTGGAATCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081204.1-4200s21c1
Sequence:CCGGCTGATTGATCGACGACATTTACTCGAGTAAATGTCGTCGATCAATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-683s21c1
Sequence:CCGGGTCTGACTTCACAATTGATTTCTCGAGAAATCAATTGTGAAGTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081204
B3GALTL MISSION shRNA shRNA Plasmid DNA
beta 1,3-galactosyltransferase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-480s21c1
Sequence:CCGGCTAGACACACTCAGACGATATCTCGAGATATCGTCTGAGTGTGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-199s21c1
Sequence:CCGGGGAGACATGACATAGACTTAACTCGAGTTAAGTCTATGTCATGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-1419s21c1
Sequence:CCGGCATCAGATTCCAGTATCATTTCTCGAGAAATGATACTGGAATCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081204.1-4200s21c1
Sequence:CCGGCTGATTGATCGACGACATTTACTCGAGTAAATGTCGTCGATCAATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-683s21c1
Sequence:CCGGGTCTGACTTCACAATTGATTTCTCGAGAAATCAATTGTGAAGTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081204
B3GALTL MISSION shRNA Lentiviral Transduction Particles
beta 1,3-galactosyltransferase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-480s21c1
Sequence:CCGGCTAGACACACTCAGACGATATCTCGAGATATCGTCTGAGTGTGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-199s21c1
Sequence:CCGGGGAGACATGACATAGACTTAACTCGAGTTAAGTCTATGTCATGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-1419s21c1
Sequence:CCGGCATCAGATTCCAGTATCATTTCTCGAGAAATGATACTGGAATCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081204.1-4200s21c1
Sequence:CCGGCTGATTGATCGACGACATTTACTCGAGTAAATGTCGTCGATCAATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081204.1-683s21c1
Sequence:CCGGGTCTGACTTCACAATTGATTTCTCGAGAAATCAATTGTGAAGTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)