EMAIL THIS PAGE TO A FRIEND

B3GAT1

beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)

63 Gene Product Result for
Synonyms: CD57 GLCATP GLCUATP HNK1 LEU7 NK-1 NK1
UniProtKB ID: Q9P2W7, Q96FS7
Gene ID:
Human(27087) Summary: The protein encoded by this gene is a member of the glucuronyltransferase gene family. These enzymes exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product functions as the key enzyme in a glucuronyl transfer reaction during the biosynthesis of the carbohydrate epitope HNK-1 (human natural killer-1, also known as CD57 and LEU7). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(76898) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Rat(117108) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Zebrafish(548607) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
domestic cat(101096760) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
cow(541596) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Horse(100072914) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
dog(489265) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
chicken(373949) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
naked mole-rat(101710890) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
domestic guinea pig(100715995) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
sheep(101116508) beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091661 MISSION® esiRNA esiRNA human B3GAT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018644 Rosetta Predictions human pricing
NM_054025 Rosetta Predictions human pricing
NM_054003 Rosetta Predictions rat pricing
NM_029792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085123 predicted 1422
2 SASI_Hs01_00085124 predicted 1446
3 SASI_Hs01_00085125 predicted 1723
4 SASI_Hs01_00085126 predicted 1340
5 SASI_Hs01_00085127 predicted 848
6 SASI_Hs01_00085129 predicted 1364
7 SASI_Hs01_00085130 predicted 1331
8 SASI_Hs01_00085131 predicted 1054
9 SASI_Hs01_00085132 predicted 519
10 SASI_Hs02_00352144 predicted 966
11 SASI_Hs01_00085128 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172253 predicted 1552
2 SASI_Hs01_00172254 predicted 1585
3 SASI_Hs01_00172255 predicted 1859
4 SASI_Hs01_00172256 predicted 1474
5 SASI_Hs01_00172257 predicted 986
6 SASI_Hs01_00172259 predicted 1491
7 SASI_Hs01_00172260 predicted 1466
8 SASI_Hs01_00172261 predicted 1190
9 SASI_Hs01_00172262 predicted 645
10 SASI_Hs02_00361958 predicted 1090
11 SASI_Hs01_00172258 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077495 predicted 1407
2 SASI_Rn01_00077496 predicted 805
3 SASI_Rn01_00077497 predicted 1006
4 SASI_Rn01_00077498 predicted 1383
5 SASI_Rn01_00077499 predicted 531
6 SASI_Rn01_00077500 predicted 788
7 SASI_Rn01_00077501 predicted 220
8 SASI_Rn01_00077503 predicted 827
9 SASI_Rn01_00077504 predicted 385
10 SASI_Rn02_00267007 predicted 1594
11 SASI_Rn01_00077502 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120747 predicted 1490
2 SASI_Mm01_00120748 predicted 1382
3 SASI_Mm01_00120749 predicted 991
4 SASI_Mm01_00120750 predicted 1311
5 SASI_Mm01_00120751 predicted 1112
6 SASI_Mm01_00120752 predicted 1371
7 SASI_Mm01_00120753 predicted 651
8 SASI_Mm01_00120754 predicted 1369
9 SASI_Mm01_00120755 predicted 1484
10 SASI_Mm01_00120756 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018644
B3GAT1 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2524s1c1
Sequence:CCGGCCACTTTCCATCCTGGAGAAACTCGAGTTTCTCCAGGATGGAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2709s1c1
Sequence:CCGGGCGTACTGAAGAGGTGTTTATCTCGAGATAAACACCTCTTCAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2420s1c1
Sequence:CCGGGCACACTGCTTTGGAAATTATCTCGAGATAATTTCCAAAGCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2710s1c1
Sequence:CCGGCGTACTGAAGAGGTGTTTATTCTCGAGAATAAACACCTCTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018644.2-1015s1c1
Sequence:CCGGGCAATAGACATGGCTGGATTTCTCGAGAAATCCAGCCATGTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-1417s1c1
Sequence:CCGGCCAGAACAAAGGACAGAGAATCTCGAGATTCTCTGTCCTTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018644.2-1009s1c1
Sequence:CCGGCCATTTGCAATAGACATGGCTCTCGAGAGCCATGTCTATTGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018644
B3GAT1 MISSION shRNA shRNA Plasmid DNA
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2524s1c1
Sequence:CCGGCCACTTTCCATCCTGGAGAAACTCGAGTTTCTCCAGGATGGAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2709s1c1
Sequence:CCGGGCGTACTGAAGAGGTGTTTATCTCGAGATAAACACCTCTTCAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2420s1c1
Sequence:CCGGGCACACTGCTTTGGAAATTATCTCGAGATAATTTCCAAAGCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2710s1c1
Sequence:CCGGCGTACTGAAGAGGTGTTTATTCTCGAGAATAAACACCTCTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018644.2-1015s1c1
Sequence:CCGGGCAATAGACATGGCTGGATTTCTCGAGAAATCCAGCCATGTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-1417s1c1
Sequence:CCGGCCAGAACAAAGGACAGAGAATCTCGAGATTCTCTGTCCTTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018644.2-1009s1c1
Sequence:CCGGCCATTTGCAATAGACATGGCTCTCGAGAGCCATGTCTATTGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018644
B3GAT1 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2524s1c1
Sequence:CCGGCCACTTTCCATCCTGGAGAAACTCGAGTTTCTCCAGGATGGAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152501    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2709s1c1
Sequence:CCGGGCGTACTGAAGAGGTGTTTATCTCGAGATAAACACCTCTTCAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2420s1c1
Sequence:CCGGGCACACTGCTTTGGAAATTATCTCGAGATAATTTCCAAAGCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-2710s1c1
Sequence:CCGGCGTACTGAAGAGGTGTTTATTCTCGAGAATAAACACCTCTTCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018644.2-1015s1c1
Sequence:CCGGGCAATAGACATGGCTGGATTTCTCGAGAAATCCAGCCATGTCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018644.2-1417s1c1
Sequence:CCGGCCAGAACAAAGGACAGAGAATCTCGAGATTCTCTGTCCTTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018644.2-1009s1c1
Sequence:CCGGCCATTTGCAATAGACATGGCTCTCGAGAGCCATGTCTATTGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029792
B3GAT1 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029792.1-1352s1c1
Sequence:CCGGCCCAGCTTGATGTCAGGATAACTCGAGTTATCCTGACATCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-785s1c1
Sequence:CCGGGTAGTGTACTTCGCGGATGATCTCGAGATCATCCGCGAAGTACACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-1028s1c1
Sequence:CCGGGCCTACTTTAAGCTACGTGGTCTCGAGACCACGTAGCTTAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-1018s1c1
Sequence:CCGGGCGAAGTCAAGCCTACTTTAACTCGAGTTAAAGTAGGCTTGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-649s1c1
Sequence:CCGGGCACGTAGAGACACCACGCAACTCGAGTTGCGTGGTGTCTCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029792
B3GAT1 MISSION shRNA shRNA Plasmid DNA
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029792.1-1352s1c1
Sequence:CCGGCCCAGCTTGATGTCAGGATAACTCGAGTTATCCTGACATCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-785s1c1
Sequence:CCGGGTAGTGTACTTCGCGGATGATCTCGAGATCATCCGCGAAGTACACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-1028s1c1
Sequence:CCGGGCCTACTTTAAGCTACGTGGTCTCGAGACCACGTAGCTTAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-1018s1c1
Sequence:CCGGGCGAAGTCAAGCCTACTTTAACTCGAGTTAAAGTAGGCTTGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-649s1c1
Sequence:CCGGGCACGTAGAGACACCACGCAACTCGAGTTGCGTGGTGTCTCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029792
B3GAT1 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029792.1-1352s1c1
Sequence:CCGGCCCAGCTTGATGTCAGGATAACTCGAGTTATCCTGACATCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-785s1c1
Sequence:CCGGGTAGTGTACTTCGCGGATGATCTCGAGATCATCCGCGAAGTACACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-1028s1c1
Sequence:CCGGGCCTACTTTAAGCTACGTGGTCTCGAGACCACGTAGCTTAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-1018s1c1
Sequence:CCGGGCGAAGTCAAGCCTACTTTAACTCGAGTTAAAGTAGGCTTGACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029792.1-649s1c1
Sequence:CCGGGCACGTAGAGACACCACGCAACTCGAGTTGCGTGGTGTCTCTACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks