EMAIL THIS PAGE TO A FRIEND

B3GAT2

beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)

50 Gene Product Result for
Synonyms: GLCATS
UniProtKB ID: Q9NPZ5, Q5JS09, Q8TF38, Q96NK4
Gene ID:
Human(135152) Summary: The product of this gene is a transmembrane protein belonging to the glucuronyltransferase family, and catalyzes the transfer of a beta-1,3 linked glucuronic acid to a terminal galactose in different glycoproteins or glycolipids containing a Gal-beta-1-4GlcNAc or Gal-beta-1-3GlcNAc residue. The encoded protein is involved in the synthesis of the human natural killer-1 (HNK-1) carbohydrate epitope, a sulfated trisaccharide implicated in cellular migration and adhesion in the nervous system. [provided by RefSeq, Jul 2008]
Mouse(280645) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Rat(64544) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
sheep(101102248) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
domestic guinea pig(100722584) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
naked mole-rat(101709113) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Zebrafish(445060) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
cow(541595) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
domestic cat(101087404) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
dog(481875) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
chicken(428638) beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080742 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080742 Rosetta Predictions human pricing
NM_022609 Rosetta Predictions rat pricing
NM_172124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070081 predicted 1212
2 SASI_Hs02_00362529 predicted 1674
3 SASI_Hs02_00362530 predicted 1696
4 SASI_Hs01_00070082 predicted 1377
5 SASI_Hs02_00362531 predicted 1702
6 SASI_Hs02_00362532 predicted 1508
7 SASI_Hs02_00362533 predicted 690
8 SASI_Hs01_00070085 predicted 1383
9 SASI_Hs02_00362534 predicted 1513
10 SASI_Hs01_00070086 predicted 1324
11 SASI_Hs01_00070083 predicted 569
12 SASI_Hs01_00070084 predicted 651
13 SASI_Hs01_00070087 predicted 690
14 SASI_Hs01_00070088 predicted 203
15 SASI_Hs01_00070089 predicted 590
16 SASI_Hs01_00070090 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110632 predicted 1727
2 SASI_Rn01_00110633 predicted 748
3 SASI_Rn01_00110634 predicted 744
4 SASI_Rn01_00110635 predicted 676
5 SASI_Rn01_00110636 predicted 1721
6 SASI_Rn01_00110637 predicted 1462
7 SASI_Rn01_00110638 predicted 1591
8 SASI_Rn01_00110640 predicted 1699
9 SASI_Rn01_00110641 predicted 1543
10 SASI_Rn02_00263376 predicted 1359
11 SASI_Rn01_00110639 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192355 predicted 748
2 SASI_Mm02_00343661 predicted 1384
3 SASI_Mm02_00343662 predicted 952
4 SASI_Mm01_00192356 predicted 1609
5 SASI_Mm01_00192358 predicted 1592
6 SASI_Mm01_00192359 predicted 1662
7 SASI_Mm01_00192361 predicted 1460
8 SASI_Mm01_00192362 predicted 1474
9 SASI_Mm01_00192363 predicted 1426
10 SASI_Mm01_00192364 predicted 2161
11 SASI_Mm01_00192357 predicted 1675
12 SASI_Mm01_00192360 predicted 1477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172124
B3GAT2 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1616s1c1
Sequence:CCGGCGGACAGAGAAGGTCAATCTACTCGAGTAGATTGACCTTCTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1479s1c1
Sequence:CCGGCCAATCCGAAAGCTGTATTTACTCGAGTAAATACAGCTTTCGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1480s1c1
Sequence:CCGGCAATCCGAAAGCTGTATTTAACTCGAGTTAAATACAGCTTTCGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172124.2-3413s1c1
Sequence:CCGGCCTCTCTATTAACATCCTAAACTCGAGTTTAGGATGTTAATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1359s1c1
Sequence:CCGGGCTATGAACGTCCGTTGGTAACTCGAGTTACCAACGGACGTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172124
B3GAT2 MISSION shRNA shRNA Plasmid DNA
beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1616s1c1
Sequence:CCGGCGGACAGAGAAGGTCAATCTACTCGAGTAGATTGACCTTCTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1479s1c1
Sequence:CCGGCCAATCCGAAAGCTGTATTTACTCGAGTAAATACAGCTTTCGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1480s1c1
Sequence:CCGGCAATCCGAAAGCTGTATTTAACTCGAGTTAAATACAGCTTTCGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172124.2-3413s1c1
Sequence:CCGGCCTCTCTATTAACATCCTAAACTCGAGTTTAGGATGTTAATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1359s1c1
Sequence:CCGGGCTATGAACGTCCGTTGGTAACTCGAGTTACCAACGGACGTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172124
B3GAT2 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1616s1c1
Sequence:CCGGCGGACAGAGAAGGTCAATCTACTCGAGTAGATTGACCTTCTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1479s1c1
Sequence:CCGGCCAATCCGAAAGCTGTATTTACTCGAGTAAATACAGCTTTCGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1480s1c1
Sequence:CCGGCAATCCGAAAGCTGTATTTAACTCGAGTTAAATACAGCTTTCGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172124.2-3413s1c1
Sequence:CCGGCCTCTCTATTAACATCCTAAACTCGAGTTTAGGATGTTAATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172124.2-1359s1c1
Sequence:CCGGGCTATGAACGTCCGTTGGTAACTCGAGTTACCAACGGACGTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080742
B3GAT2 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-721s1c1
Sequence:CCGGGCCATCGACATGGCAGGATTTCTCGAGAAATCCTGCCATGTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-728s1c1
Sequence:CCGGACATGGCAGGATTTGCTGTAACTCGAGTTACAGCAAATCCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-246s1c1
Sequence:CCGGCTATGCCATCACGCCCACCTACTCGAGTAGGTGGGCGTGATGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-42s1c1
Sequence:CCGGCTGGATCCTAATTGTCATCATCTCGAGATGATGACAATTAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-674s1c1
Sequence:CCGGGCAAAGTTGTTGGCTGGTACACTCGAGTGTACCAGCCAACAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080742.2-1654s21c1
Sequence:CCGGGTCCAGCCAGTGGATCCATATCTCGAGATATGGATCCACTGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080742.2-1465s21c1
Sequence:CCGGGGATGCAAGAATCTGACTTTCCTCGAGGAAAGTCAGATTCTTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080742
B3GAT2 MISSION shRNA shRNA Plasmid DNA
beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-721s1c1
Sequence:CCGGGCCATCGACATGGCAGGATTTCTCGAGAAATCCTGCCATGTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-728s1c1
Sequence:CCGGACATGGCAGGATTTGCTGTAACTCGAGTTACAGCAAATCCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-246s1c1
Sequence:CCGGCTATGCCATCACGCCCACCTACTCGAGTAGGTGGGCGTGATGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-42s1c1
Sequence:CCGGCTGGATCCTAATTGTCATCATCTCGAGATGATGACAATTAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-674s1c1
Sequence:CCGGGCAAAGTTGTTGGCTGGTACACTCGAGTGTACCAGCCAACAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080742.2-1654s21c1
Sequence:CCGGGTCCAGCCAGTGGATCCATATCTCGAGATATGGATCCACTGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080742.2-1465s21c1
Sequence:CCGGGGATGCAAGAATCTGACTTTCCTCGAGGAAAGTCAGATTCTTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080742
B3GAT2 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-721s1c1
Sequence:CCGGGCCATCGACATGGCAGGATTTCTCGAGAAATCCTGCCATGTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-728s1c1
Sequence:CCGGACATGGCAGGATTTGCTGTAACTCGAGTTACAGCAAATCCTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-246s1c1
Sequence:CCGGCTATGCCATCACGCCCACCTACTCGAGTAGGTGGGCGTGATGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-42s1c1
Sequence:CCGGCTGGATCCTAATTGTCATCATCTCGAGATGATGACAATTAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080742.1-674s1c1
Sequence:CCGGGCAAAGTTGTTGGCTGGTACACTCGAGTGTACCAGCCAACAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080742.2-1654s21c1
Sequence:CCGGGTCCAGCCAGTGGATCCATATCTCGAGATATGGATCCACTGGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080742.2-1465s21c1
Sequence:CCGGGGATGCAAGAATCTGACTTTCCTCGAGGAAAGTCAGATTCTTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks