EMAIL THIS PAGE TO A FRIEND

B3GAT3

beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

132 Gene Product Result for
Synonyms: GLCATI
UniProtKB ID: O94766, Q96I06, Q9UEP0
Gene ID:
Human(26229) Summary: The protein encoded by this gene is a member of the glucuronyltransferase gene family, enzymes that exhibit strict acceptor specificity, recognizing nonreducing terminal sugars and their anomeric linkages. This gene product catalyzes the formation of the glycosaminoglycan-protein linkage by way of a glucuronyl transfer reaction in the final step of the biosynthesis of the linkage region of proteoglycans. [provided by RefSeq, Jul 2008]
Mouse(72727) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Rat(293722) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Zebrafish(192334) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
domestic cat(101089044) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
cow(404162) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
dog(483785) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
chicken(374151) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
naked mole-rat(101717898) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
domestic guinea pig(100731926) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Goat(100861112) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
sheep(101111917) beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012200 Rosetta Predictions human pricing
NM_001128184 Rosetta Predictions rat pricing
XM_238155 Rosetta Predictions rat pricing
NM_024256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212326 predicted 301
2 SASI_Hs02_00343850 predicted 774
3 SASI_Hs01_00212328 predicted 820
4 SASI_Hs01_00212329 predicted 243
5 SASI_Hs01_00212330 predicted 588
6 SASI_Hs01_00212331 predicted 244
7 SASI_Hs01_00212332 predicted 764
8 SASI_Hs01_00212333 predicted 494
9 SASI_Hs01_00212334 predicted 580
10 SASI_Hs01_00212335 predicted 715
11 SASI_Hs01_00212327 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255030 predicted 725
2 SASI_Rn02_00255031 predicted 770
3 SASI_Rn02_00255032 predicted 665
4 SASI_Rn02_00255033 predicted 863
5 SASI_Rn02_00255034 predicted 787
6 SASI_Rn02_00255035 predicted 752
7 SASI_Rn02_00255036 predicted 944
8 SASI_Rn02_00255037 predicted 876
9 SASI_Rn02_00255038 predicted 791
10 SASI_Rn02_00255039 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131561 predicted 773
2 SASI_Rn01_00131562 predicted 676
3 SASI_Rn01_00131563 predicted 864
4 SASI_Rn01_00131564 predicted 799
5 SASI_Rn01_00131565 predicted 752
6 SASI_Rn01_00131566 predicted 943
7 SASI_Rn01_00131567 predicted 884
8 SASI_Rn01_00131568 predicted 799
9 SASI_Rn01_00131569 predicted 972
10 SASI_Rn01_00131570 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026445 predicted 728
2 SASI_Mm02_00327645 predicted 906
3 SASI_Mm01_00026446 predicted 387
4 SASI_Mm01_00026447 predicted 748
5 SASI_Mm01_00026448 predicted 758
6 SASI_Mm01_00026449 predicted 415
7 SASI_Mm01_00026450 predicted 329
8 SASI_Mm01_00026451 predicted 971
9 SASI_Mm01_00026453 predicted 590
10 SASI_Mm01_00026454 predicted 856
11 SASI_Mm01_00026452 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012200
VALIDATED
B3GAT3 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-278s21c1
Sequence:CCGGCTATGCCAGGCTGGTACAGAACTCGAGTTCTGTACCAGCCTGGCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-880s21c1
Sequence:CCGGTTCTGAGCCACCTTGTGGATCCTCGAGGATCCACAAGGTGGCTCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-1018s21c1
Sequence:CCGGACCCAGCAATTGAGGTGTGATCTCGAGATCACACCTCAATTGCTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-157s21c1
Sequence:CCGGAGCTACGGCAGAAGGATCTGACTCGAGTCAGATCCTTCTGCCGTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-246s1c1
Sequence:CCGGGCCCTGCCTACTATCTATGTTCTCGAGAACATAGATAGTAGGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-594s1c1
Sequence:CCGGGTCGTCTACTTTGCTGACGATCTCGAGATCGTCAGCAAAGTAGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-822s1c1
Sequence:CCGGGATAAGCCCAATGCCCAATTTCTCGAGAAATTGGGCATTGGGCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-959s1c1
Sequence:CCGGGACAGAGAAGCCCAAGATGAACTCGAGTTCATCTTGGGCTTCTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-804s1c1
Sequence:CCGGGCCCTGCCCTTGCTGTTAGATCTCGAGATCTAACAGCAAGGGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012200
VALIDATED
B3GAT3 MISSION shRNA shRNA Plasmid DNA
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-278s21c1
Sequence:CCGGCTATGCCAGGCTGGTACAGAACTCGAGTTCTGTACCAGCCTGGCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-880s21c1
Sequence:CCGGTTCTGAGCCACCTTGTGGATCCTCGAGGATCCACAAGGTGGCTCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-1018s21c1
Sequence:CCGGACCCAGCAATTGAGGTGTGATCTCGAGATCACACCTCAATTGCTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-157s21c1
Sequence:CCGGAGCTACGGCAGAAGGATCTGACTCGAGTCAGATCCTTCTGCCGTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-246s1c1
Sequence:CCGGGCCCTGCCTACTATCTATGTTCTCGAGAACATAGATAGTAGGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-594s1c1
Sequence:CCGGGTCGTCTACTTTGCTGACGATCTCGAGATCGTCAGCAAAGTAGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-822s1c1
Sequence:CCGGGATAAGCCCAATGCCCAATTTCTCGAGAAATTGGGCATTGGGCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-959s1c1
Sequence:CCGGGACAGAGAAGCCCAAGATGAACTCGAGTTCATCTTGGGCTTCTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-804s1c1
Sequence:CCGGGCCCTGCCCTTGCTGTTAGATCTCGAGATCTAACAGCAAGGGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012200
VALIDATED
B3GAT3 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-278s21c1
Sequence:CCGGCTATGCCAGGCTGGTACAGAACTCGAGTTCTGTACCAGCCTGGCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-880s21c1
Sequence:CCGGTTCTGAGCCACCTTGTGGATCCTCGAGGATCCACAAGGTGGCTCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-1018s21c1
Sequence:CCGGACCCAGCAATTGAGGTGTGATCTCGAGATCACACCTCAATTGCTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012200.2-157s21c1
Sequence:CCGGAGCTACGGCAGAAGGATCTGACTCGAGTCAGATCCTTCTGCCGTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-246s1c1
Sequence:CCGGGCCCTGCCTACTATCTATGTTCTCGAGAACATAGATAGTAGGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-594s1c1
Sequence:CCGGGTCGTCTACTTTGCTGACGATCTCGAGATCGTCAGCAAAGTAGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-822s1c1
Sequence:CCGGGATAAGCCCAATGCCCAATTTCTCGAGAAATTGGGCATTGGGCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-959s1c1
Sequence:CCGGGACAGAGAAGCCCAAGATGAACTCGAGTTCATCTTGGGCTTCTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012200.2-804s1c1
Sequence:CCGGGCCCTGCCCTTGCTGTTAGATCTCGAGATCTAACAGCAAGGGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024256
B3GAT3 MISSION shRNA Bacterial Glycerol Stock
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024256.2-1192s1c1
Sequence:CCGGCACCCTGACTTCTACCTTATTCTCGAGAATAAGGTAGAAGTCAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-1066s1c1
Sequence:CCGGGCTGCCAATTGTACTCAGGTACTCGAGTACCTGAGTACAATTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-393s1c1
Sequence:CCGGCCTGCCTACTATCTATGTCATCTCGAGATGACATAGATAGTAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-319s1c1
Sequence:CCGGCTGAGGATATCCCAGTTGCAACTCGAGTTGCAACTGGGATATCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-922s1c1
Sequence:CCGGCCCTTGGACATGGCGGGATTTCTCGAGAAATCCCGCCATGTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024256
B3GAT3 MISSION shRNA shRNA Plasmid DNA
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024256.2-1192s1c1
Sequence:CCGGCACCCTGACTTCTACCTTATTCTCGAGAATAAGGTAGAAGTCAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-1066s1c1
Sequence:CCGGGCTGCCAATTGTACTCAGGTACTCGAGTACCTGAGTACAATTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-393s1c1
Sequence:CCGGCCTGCCTACTATCTATGTCATCTCGAGATGACATAGATAGTAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-319s1c1
Sequence:CCGGCTGAGGATATCCCAGTTGCAACTCGAGTTGCAACTGGGATATCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-922s1c1
Sequence:CCGGCCCTTGGACATGGCGGGATTTCTCGAGAAATCCCGCCATGTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024256
B3GAT3 MISSION shRNA Lentiviral Transduction Particles
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024256.2-1192s1c1
Sequence:CCGGCACCCTGACTTCTACCTTATTCTCGAGAATAAGGTAGAAGTCAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-1066s1c1
Sequence:CCGGGCTGCCAATTGTACTCAGGTACTCGAGTACCTGAGTACAATTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-393s1c1
Sequence:CCGGCCTGCCTACTATCTATGTCATCTCGAGATGACATAGATAGTAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-319s1c1
Sequence:CCGGCTGAGGATATCCCAGTTGCAACTCGAGTTGCAACTGGGATATCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024256.2-922s1c1
Sequence:CCGGCCCTTGGACATGGCGGGATTTCTCGAGAAATCCCGCCATGTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)