EMAIL THIS PAGE TO A FRIEND

B3GNT1

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1

107 Gene Product Result for
Synonyms: B3GN-T1 B3GNT6 BETA3GNTI MDDGA13 iGAT iGNT
UniProtKB ID: O43505, Q4TTN0
Gene ID:
Human(11041) Summary: This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein. It is essential for the synthesis of poly-N-acetyllactosamine, a determinant for the blood group i antigen. [provided by RefSeq, Jul 2008]
Mouse(108902) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Rat(293667) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Zebrafish(101669768) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
domestic cat(101084574) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
cow(618055) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
dog(476013) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
sheep(101105702) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
domestic guinea pig(100714753) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
naked mole-rat(101724680) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006876 Rosetta Predictions human pricing
NM_001106324 Rosetta Predictions rat pricing
NM_175383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198489 predicted 1144
2 SASI_Hs01_00198490 predicted 1172
3 SASI_Hs02_00342524 predicted 794
4 SASI_Hs02_00342525 predicted 1234
5 SASI_Hs01_00198491 predicted 1166
6 SASI_Hs01_00198492 predicted 1047
7 SASI_Hs01_00198493 predicted 1165
8 SASI_Hs02_00342526 predicted 1069
9 SASI_Hs01_00198496 predicted 1037
10 SASI_Hs01_00198497 predicted 1159
11 SASI_Hs01_00198494 predicted 370
12 SASI_Hs01_00198495 predicted 1267
13 SASI_Hs01_00198498 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217848 predicted 1109
2 SASI_Rn02_00217849 predicted 1109
3 SASI_Rn02_00217850 predicted 1258
4 SASI_Rn02_00217851 predicted 1209
5 SASI_Rn02_00217852 predicted 1092
6 SASI_Rn02_00217853 predicted 911
7 SASI_Rn02_00217854 predicted 707
8 SASI_Rn02_00217855 predicted 259
9 SASI_Rn02_00217856 predicted 706
10 SASI_Rn02_00217857 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054516 predicted 1177
2 SASI_Mm02_00346212 predicted 802
3 SASI_Mm01_00054517 predicted 1326
4 SASI_Mm01_00054518 predicted 1174
5 SASI_Mm02_00346213 predicted 1155
6 SASI_Mm01_00054519 predicted 1274
7 SASI_Mm01_00054520 predicted 763
8 SASI_Mm01_00054522 predicted 975
9 SASI_Mm01_00054523 predicted 803
10 SASI_Mm01_00054524 predicted 462
11 SASI_Mm01_00054521 predicted 332
12 SASI_Mm01_00054525 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175383
VALIDATED
B3GNT1 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175383.1-1830s1c1
Sequence:CCGGCGTAGAATGTAGTGCTAAGAACTCGAGTTCTTAGCACTACATTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-1295s1c1
Sequence:CCGGCCAGCGCAATAAGATCCTTTACTCGAGTAAAGGATCTTATTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-708s1c1
Sequence:CCGGCCCGGGATTAATTATGCACTACTCGAGTAGTGCATAATTAATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-1131s1c1
Sequence:CCGGCCCACATTTGACGAACGCTTTCTCGAGAAAGCGTTCGTCAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-747s1c1
Sequence:CCGGCCCAATAACCTGTTAAGGAATCTCGAGATTCCTTAACAGGTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1218s21c1
Sequence:CCGGTGCACGTGGCAGGGTTTAATTCTCGAGAATTAAACCCTGCCACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-368s21c1
Sequence:CCGGCTAGATGCCAGCGGCGATTATCTCGAGATAATCGCCGCTGGCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1682s21c1
Sequence:CCGGTCCTGTAAACTTCGTACAAATCTCGAGATTTGTACGAAGTTTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1167s21c1
Sequence:CCGGACGAACGCTTTCGGCAGTATGCTCGAGCATACTGCCGAAAGCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175383.2-311s21c1
Sequence:CCGGCGATCCGTAGACCAGGTAAAGCTCGAGCTTTACCTGGTCTACGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175383
VALIDATED
B3GNT1 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175383.1-1830s1c1
Sequence:CCGGCGTAGAATGTAGTGCTAAGAACTCGAGTTCTTAGCACTACATTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-1295s1c1
Sequence:CCGGCCAGCGCAATAAGATCCTTTACTCGAGTAAAGGATCTTATTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-708s1c1
Sequence:CCGGCCCGGGATTAATTATGCACTACTCGAGTAGTGCATAATTAATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-1131s1c1
Sequence:CCGGCCCACATTTGACGAACGCTTTCTCGAGAAAGCGTTCGTCAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-747s1c1
Sequence:CCGGCCCAATAACCTGTTAAGGAATCTCGAGATTCCTTAACAGGTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1218s21c1
Sequence:CCGGTGCACGTGGCAGGGTTTAATTCTCGAGAATTAAACCCTGCCACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-368s21c1
Sequence:CCGGCTAGATGCCAGCGGCGATTATCTCGAGATAATCGCCGCTGGCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1682s21c1
Sequence:CCGGTCCTGTAAACTTCGTACAAATCTCGAGATTTGTACGAAGTTTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1167s21c1
Sequence:CCGGACGAACGCTTTCGGCAGTATGCTCGAGCATACTGCCGAAAGCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175383.2-311s21c1
Sequence:CCGGCGATCCGTAGACCAGGTAAAGCTCGAGCTTTACCTGGTCTACGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175383
VALIDATED
B3GNT1 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175383.1-1830s1c1
Sequence:CCGGCGTAGAATGTAGTGCTAAGAACTCGAGTTCTTAGCACTACATTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-1295s1c1
Sequence:CCGGCCAGCGCAATAAGATCCTTTACTCGAGTAAAGGATCTTATTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-708s1c1
Sequence:CCGGCCCGGGATTAATTATGCACTACTCGAGTAGTGCATAATTAATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-1131s1c1
Sequence:CCGGCCCACATTTGACGAACGCTTTCTCGAGAAAGCGTTCGTCAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175383.1-747s1c1
Sequence:CCGGCCCAATAACCTGTTAAGGAATCTCGAGATTCCTTAACAGGTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1218s21c1
Sequence:CCGGTGCACGTGGCAGGGTTTAATTCTCGAGAATTAAACCCTGCCACGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-368s21c1
Sequence:CCGGCTAGATGCCAGCGGCGATTATCTCGAGATAATCGCCGCTGGCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1682s21c1
Sequence:CCGGTCCTGTAAACTTCGTACAAATCTCGAGATTTGTACGAAGTTTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175383.2-1167s21c1
Sequence:CCGGACGAACGCTTTCGGCAGTATGCTCGAGCATACTGCCGAAAGCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175383.2-311s21c1
Sequence:CCGGCGATCCGTAGACCAGGTAAAGCTCGAGCTTTACCTGGTCTACGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006876
VALIDATED
B3GNT1 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1180s1c1
Sequence:CCGGCGAAGGTTTCTTGGTTCATAACTCGAGTTATGAACCAAGAAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1272s1c1
Sequence:CCGGGCCAGTTCAAACAGGAGTTGACTCGAGTCAACTCCTGTTTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-195s1c1
Sequence:CCGGAGGAGGAGCAAGACCAATATTCTCGAGAATATTGGTCTTGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1250s1c1
Sequence:CCGGCAGCACAATAAGATCCTATATCTCGAGATATAGGATCTTATTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-701s1c1
Sequence:CCGGCCCAATAACCTGCTGAGGAATCTCGAGATTCCTCAGCAGGTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006876.2-999s21c1
Sequence:CCGGGGCCCTTCTATTATGGGTTGTCTCGAGACAACCCATAATAGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-808s21c1
Sequence:CCGGCTATGCCCTGGTGATCGATGTCTCGAGACATCGATCACCAGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006876.2-738s21c1
Sequence:CCGGATTATGCGCTGGGCACCAATGCTCGAGCATTGGTGCCCAGCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-1692s21c1
Sequence:CCGGTTCTGTAAGCTTCGTACAAATCTCGAGATTTGTACGAAGCTTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-1316s21c1
Sequence:CCGGCAGCACAATAAGATCCTATATCTCGAGATATAGGATCTTATTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006876
VALIDATED
B3GNT1 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1180s1c1
Sequence:CCGGCGAAGGTTTCTTGGTTCATAACTCGAGTTATGAACCAAGAAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1272s1c1
Sequence:CCGGGCCAGTTCAAACAGGAGTTGACTCGAGTCAACTCCTGTTTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-195s1c1
Sequence:CCGGAGGAGGAGCAAGACCAATATTCTCGAGAATATTGGTCTTGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1250s1c1
Sequence:CCGGCAGCACAATAAGATCCTATATCTCGAGATATAGGATCTTATTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-701s1c1
Sequence:CCGGCCCAATAACCTGCTGAGGAATCTCGAGATTCCTCAGCAGGTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006876.2-999s21c1
Sequence:CCGGGGCCCTTCTATTATGGGTTGTCTCGAGACAACCCATAATAGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-808s21c1
Sequence:CCGGCTATGCCCTGGTGATCGATGTCTCGAGACATCGATCACCAGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006876.2-738s21c1
Sequence:CCGGATTATGCGCTGGGCACCAATGCTCGAGCATTGGTGCCCAGCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-1692s21c1
Sequence:CCGGTTCTGTAAGCTTCGTACAAATCTCGAGATTTGTACGAAGCTTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-1316s21c1
Sequence:CCGGCAGCACAATAAGATCCTATATCTCGAGATATAGGATCTTATTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006876
VALIDATED
B3GNT1 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1180s1c1
Sequence:CCGGCGAAGGTTTCTTGGTTCATAACTCGAGTTATGAACCAAGAAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1272s1c1
Sequence:CCGGGCCAGTTCAAACAGGAGTTGACTCGAGTCAACTCCTGTTTGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-195s1c1
Sequence:CCGGAGGAGGAGCAAGACCAATATTCTCGAGAATATTGGTCTTGCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-1250s1c1
Sequence:CCGGCAGCACAATAAGATCCTATATCTCGAGATATAGGATCTTATTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006876.1-701s1c1
Sequence:CCGGCCCAATAACCTGCTGAGGAATCTCGAGATTCCTCAGCAGGTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006876.2-999s21c1
Sequence:CCGGGGCCCTTCTATTATGGGTTGTCTCGAGACAACCCATAATAGAAGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-808s21c1
Sequence:CCGGCTATGCCCTGGTGATCGATGTCTCGAGACATCGATCACCAGGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006876.2-738s21c1
Sequence:CCGGATTATGCGCTGGGCACCAATGCTCGAGCATTGGTGCCCAGCGCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-1692s21c1
Sequence:CCGGTTCTGTAAGCTTCGTACAAATCTCGAGATTTGTACGAAGCTTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006876.2-1316s21c1
Sequence:CCGGCAGCACAATAAGATCCTATATCTCGAGATATAGGATCTTATTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks