EMAIL THIS PAGE TO A FRIEND

B3GNT2

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2

79 Gene Product Result for
Synonyms: B3GN-T2 B3GNT B3GNT-2 B3GNT1 BETA3GNT BGNT2 BGnT-2
UniProtKB ID: Q9NY97, Q54AC1, Q9NQQ9, Q9NQR0, Q9NUT9
Gene ID:
Human(10678) Summary: This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein. It prefers the substrate of lacto-N-neotetraose, and is involved in the biosynthesis of poly-N-acetyllactosamine chains. [provided by RefSeq, Jul 2008]
Mouse(53625) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Rat(305571) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
naked mole-rat(101723595) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
domestic guinea pig(100716065) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
sheep(101117403) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Domestic Rabbit(100355603) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Domestic Rabbit(100342947) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
chicken(421286) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
cow(515585) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
domestic cat(101080523) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
dog(474611) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1279 Human B3GNT2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006577 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006577 Rosetta Predictions human pricing
NM_001107240 Rosetta Predictions rat pricing
NM_016888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158864 predicted 855
2 SASI_Hs01_00158865 predicted 818
3 SASI_Hs01_00158866 predicted 561
4 SASI_Hs01_00158867 predicted 1096
5 SASI_Hs01_00158868 predicted 817
6 SASI_Hs01_00158869 predicted 1346
7 SASI_Hs01_00158870 predicted 1276
8 SASI_Hs01_00158871 predicted 1332
9 SASI_Hs01_00158872 predicted 747
10 SASI_Hs02_00341867 predicted 1036
11 SASI_Hs01_00158863 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226895 predicted 1545
2 SASI_Rn02_00226896 predicted 1648
3 SASI_Rn02_00226897 predicted 454
4 SASI_Rn02_00226898 predicted 1247
5 SASI_Rn02_00226899 predicted 1174
6 SASI_Rn02_00226900 predicted 827
7 SASI_Rn02_00226901 predicted 856
8 SASI_Rn02_00226902 predicted 1356
9 SASI_Rn02_00226903 predicted 522
10 SASI_Rn02_00226904 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119337 predicted 844
2 SASI_Mm01_00119338 predicted 1266
3 SASI_Mm01_00119340 predicted 1308
4 SASI_Mm01_00119341 predicted 633
5 SASI_Mm01_00119342 predicted 615
6 SASI_Mm01_00119344 predicted 1305
7 SASI_Mm01_00119345 predicted 588
8 SASI_Mm01_00119346 predicted 965
9 SASI_Mm02_00323720 predicted 711
10 SASI_Mm02_00323721 predicted 1364
11 SASI_Mm01_00119339 predicted 244
12 SASI_Mm01_00119343 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016888
VALIDATED
B3GNT2 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-1816s21c1
Sequence:CCGGCCCAGCAGTATTGTCCTTGTTCTCGAGAACAAGGACAATACTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-1346s21c1
Sequence:CCGGACCTCAAGAGATGATTGATATCTCGAGATATCAATCATCTCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016888.4-316s21c1
Sequence:CCGGATGGAAAGGGAGGAGTAATAACTCGAGTTATTACTCCTCCCTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-633s21c1
Sequence:CCGGCCCTTCTTACTATTGGCGATACTCGAGTATCGCCAATAGTAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-338s21c1
Sequence:CCGGCCCGAAAGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-585s1c1
Sequence:CCGGCGGAATTACTCGCTGCTTATACTCGAGTATAAGCAGCGAGTAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-338s1c1
Sequence:CCGGCCCGAAAGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-1816s1c1
Sequence:CCGGCCCAGCAGTATTGTCCTTGTTCTCGAGAACAAGGACAATACTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-584s1c1
Sequence:CCGGCCGGAATTACTCGCTGCTTATCTCGAGATAAGCAGCGAGTAATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-633s1c1
Sequence:CCGGCCCTTCTTACTATTGGCGATACTCGAGTATCGCCAATAGTAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016888
VALIDATED
B3GNT2 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-1816s21c1
Sequence:CCGGCCCAGCAGTATTGTCCTTGTTCTCGAGAACAAGGACAATACTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-1346s21c1
Sequence:CCGGACCTCAAGAGATGATTGATATCTCGAGATATCAATCATCTCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016888.4-316s21c1
Sequence:CCGGATGGAAAGGGAGGAGTAATAACTCGAGTTATTACTCCTCCCTTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-633s21c1
Sequence:CCGGCCCTTCTTACTATTGGCGATACTCGAGTATCGCCAATAGTAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-338s21c1
Sequence:CCGGCCCGAAAGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-585s1c1
Sequence:CCGGCGGAATTACTCGCTGCTTATACTCGAGTATAAGCAGCGAGTAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-338s1c1
Sequence:CCGGCCCGAAAGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-1816s1c1
Sequence:CCGGCCCAGCAGTATTGTCCTTGTTCTCGAGAACAAGGACAATACTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-584s1c1
Sequence:CCGGCCGGAATTACTCGCTGCTTATCTCGAGATAAGCAGCGAGTAATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-633s1c1
Sequence:CCGGCCCTTCTTACTATTGGCGATACTCGAGTATCGCCAATAGTAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016888
VALIDATED
B3GNT2 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-1816s21c1
Sequence:CCGGCCCAGCAGTATTGTCCTTGTTCTCGAGAACAAGGACAATACTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-1346s21c1
Sequence:CCGGACCTCAAGAGATGATTGATATCTCGAGATATCAATCATCTCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016888.4-316s21c1
Sequence:CCGGATGGAAAGGGAGGAGTAATAACTCGAGTTATTACTCCTCCCTTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-633s21c1
Sequence:CCGGCCCTTCTTACTATTGGCGATACTCGAGTATCGCCAATAGTAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016888.4-338s21c1
Sequence:CCGGCCCGAAAGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-585s1c1
Sequence:CCGGCGGAATTACTCGCTGCTTATACTCGAGTATAAGCAGCGAGTAATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-338s1c1
Sequence:CCGGCCCGAAAGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-1816s1c1
Sequence:CCGGCCCAGCAGTATTGTCCTTGTTCTCGAGAACAAGGACAATACTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-584s1c1
Sequence:CCGGCCGGAATTACTCGCTGCTTATCTCGAGATAAGCAGCGAGTAATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016888.4-633s1c1
Sequence:CCGGCCCTTCTTACTATTGGCGATACTCGAGTATCGCCAATAGTAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006577
VALIDATED
B3GNT2 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-602s21c1
Sequence:CCGGTATTTGAGATGCCGCAATTATCTCGAGATAATTGCGGCATCTCAAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-1375s21c1
Sequence:CCGGACCTCAAGAGATGATTGATATCTCGAGATATCAATCATCTCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006577.5-2057s21c1
Sequence:CCGGTGTGATGTTATGGTCATAATACTCGAGTATTATGACCATAACATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006577.5-1403s21c1
Sequence:CCGGCAGTTGCAGAGTGCTCATTTACTCGAGTAAATGAGCACTCTGCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-665s21c1
Sequence:CCGGTTCTTGTTGCTGGCGATTAAGCTCGAGCTTAATCGCCAGCAACAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-607s1c1
Sequence:CCGGGCCGCAATTATTCACTGCTTACTCGAGTAAGCAGTGAATAATTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-812s1c1
Sequence:CCGGCCTTTCAGATATGCTGAAATTCTCGAGAATTTCAGCATATCTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-494s1c1
Sequence:CCGGCTCCAATATAAGCCATCTGAACTCGAGTTCAGATGGCTTATATTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006577.3-937s1c1
Sequence:CCGGGCCCAGACACTGAGTTTGTTTCTCGAGAAACAAACTCAGTGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006577.3-635s1c1
Sequence:CCGGGCCGGATAAGTGTGCAAAGAACTCGAGTTCTTTGCACACTTATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006577
VALIDATED
B3GNT2 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-602s21c1
Sequence:CCGGTATTTGAGATGCCGCAATTATCTCGAGATAATTGCGGCATCTCAAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-1375s21c1
Sequence:CCGGACCTCAAGAGATGATTGATATCTCGAGATATCAATCATCTCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006577.5-2057s21c1
Sequence:CCGGTGTGATGTTATGGTCATAATACTCGAGTATTATGACCATAACATCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006577.5-1403s21c1
Sequence:CCGGCAGTTGCAGAGTGCTCATTTACTCGAGTAAATGAGCACTCTGCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-665s21c1
Sequence:CCGGTTCTTGTTGCTGGCGATTAAGCTCGAGCTTAATCGCCAGCAACAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-607s1c1
Sequence:CCGGGCCGCAATTATTCACTGCTTACTCGAGTAAGCAGTGAATAATTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-812s1c1
Sequence:CCGGCCTTTCAGATATGCTGAAATTCTCGAGAATTTCAGCATATCTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-494s1c1
Sequence:CCGGCTCCAATATAAGCCATCTGAACTCGAGTTCAGATGGCTTATATTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006577.3-937s1c1
Sequence:CCGGGCCCAGACACTGAGTTTGTTTCTCGAGAAACAAACTCAGTGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006577.3-635s1c1
Sequence:CCGGGCCGGATAAGTGTGCAAAGAACTCGAGTTCTTTGCACACTTATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006577
VALIDATED
B3GNT2 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-602s21c1
Sequence:CCGGTATTTGAGATGCCGCAATTATCTCGAGATAATTGCGGCATCTCAAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-1375s21c1
Sequence:CCGGACCTCAAGAGATGATTGATATCTCGAGATATCAATCATCTCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006577.5-2057s21c1
Sequence:CCGGTGTGATGTTATGGTCATAATACTCGAGTATTATGACCATAACATCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006577.5-1403s21c1
Sequence:CCGGCAGTTGCAGAGTGCTCATTTACTCGAGTAAATGAGCACTCTGCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006577.5-665s21c1
Sequence:CCGGTTCTTGTTGCTGGCGATTAAGCTCGAGCTTAATCGCCAGCAACAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-607s1c1
Sequence:CCGGGCCGCAATTATTCACTGCTTACTCGAGTAAGCAGTGAATAATTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-812s1c1
Sequence:CCGGCCTTTCAGATATGCTGAAATTCTCGAGAATTTCAGCATATCTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006577.3-494s1c1
Sequence:CCGGCTCCAATATAAGCCATCTGAACTCGAGTTCAGATGGCTTATATTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006577.3-937s1c1
Sequence:CCGGGCCCAGACACTGAGTTTGTTTCTCGAGAAACAAACTCAGTGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006577.3-635s1c1
Sequence:CCGGGCCGGATAAGTGTGCAAAGAACTCGAGTTCTTTGCACACTTATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)