EMAIL THIS PAGE TO A FRIEND

B3GNT3

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3

48 Gene Product Result for
Synonyms: B3GAL-T8 B3GN-T3 B3GNT-3 HP10328 TMEM3 beta3Gn-T3
UniProtKB ID: Q9Y2A9, B2RAS4, Q6NWU9, Q6NXU9, Q8WWR6, Q9C0J2
Gene ID:
Human(10331) Summary: This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II transmembrane protein and contains a signal anchor that is not cleaved. It prefers the substrates of lacto-N-tetraose and lacto-N-neotetraose, and is involved in the biosynthesis of poly-N-acetyllactosamine chains and the biosynthesis of the backbone structure of dimeric sialyl Lewis a. It plays dominant roles in L-selectin ligand biosynthesis, lymphocyte homing and lymphocyte trafficking. [provided by RefSeq, Jul 2008]
Mouse(72297) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Rat(290638) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Zebrafish(561172) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
dog(484831) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
cow(784997) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
domestic cat(101092089) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
sheep(101113066) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
domestic guinea pig(100713343) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU037671 MISSION® esiRNA esiRNA targeting mouse B3gnt3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014256 Rosetta Predictions human pricing
NM_001106068 Rosetta Predictions rat pricing
NM_028189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144097 predicted 1644
2 SASI_Hs01_00144098 predicted 1378
3 SASI_Hs01_00144100 predicted 1626
4 SASI_Hs01_00144101 predicted 1183
5 SASI_Hs01_00144102 predicted 650
6 SASI_Hs01_00144103 predicted 1236
7 SASI_Hs01_00144104 predicted 1559
8 SASI_Hs01_00144105 predicted 958
9 SASI_Hs02_00345315 predicted 1568
10 SASI_Hs01_00144106 predicted 1334
11 SASI_Hs01_00144099 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215312 predicted 890
2 SASI_Rn02_00215313 predicted 397
3 SASI_Rn02_00215314 predicted 729
4 SASI_Rn02_00215315 predicted 1414
5 SASI_Rn02_00215316 predicted 719
6 SASI_Rn02_00215317 predicted 726
7 SASI_Rn02_00215318 predicted 266
8 SASI_Rn02_00215319 predicted 1221
9 SASI_Rn02_00215320 predicted 1341
10 SASI_Rn02_00215321 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170406 predicted 1354
2 SASI_Mm01_00170407 predicted 1412
3 SASI_Mm01_00170408 predicted 551
4 SASI_Mm01_00170410 predicted 1401
5 SASI_Mm01_00170411 predicted 908
6 SASI_Mm01_00170409 predicted 1338
7 SASI_Mm02_00333482 predicted 534
8 SASI_Mm01_00170415 predicted 1438
9 SASI_Mm02_00333483 predicted 554
10 SASI_Mm02_00333484 predicted 609
11 SASI_Mm01_00170412 predicted 1646
12 SASI_Mm01_00170413 predicted 1497
13 SASI_Mm01_00170414 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014256
B3GNT3 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-1149s1c1
Sequence:CCGGCCGCTTCCTACCTTATGAGATCTCGAGATCTCATAAGGTAGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-702s1c1
Sequence:CCGGGCAGGAGACAAGGTGCGCCAACTCGAGTTGGCGCACCTTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-975s1c1
Sequence:CCGGTGCCCATGTCTTGGACATCTTCTCGAGAAGATGTCCAAGACATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-676s1c1
Sequence:CCGGCTCAAGCAGGTCCTGTTCTTACTCGAGTAAGAACAGGACCTGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-1212s1c1
Sequence:CCGGCGGCAATCAGACACAGATCTACTCGAGTAGATCTGTGTCTGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014256.3-1698s21c1
Sequence:CCGGCATAGAGCTGACGTGAGAAATCTCGAGATTTCTCACGTCAGCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014256.3-1385s21c1
Sequence:CCGGAGGTTTGATGAGTGAATATTCCTCGAGGAATATTCACTCATCAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014256
B3GNT3 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-1149s1c1
Sequence:CCGGCCGCTTCCTACCTTATGAGATCTCGAGATCTCATAAGGTAGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-702s1c1
Sequence:CCGGGCAGGAGACAAGGTGCGCCAACTCGAGTTGGCGCACCTTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-975s1c1
Sequence:CCGGTGCCCATGTCTTGGACATCTTCTCGAGAAGATGTCCAAGACATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-676s1c1
Sequence:CCGGCTCAAGCAGGTCCTGTTCTTACTCGAGTAAGAACAGGACCTGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-1212s1c1
Sequence:CCGGCGGCAATCAGACACAGATCTACTCGAGTAGATCTGTGTCTGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014256.3-1698s21c1
Sequence:CCGGCATAGAGCTGACGTGAGAAATCTCGAGATTTCTCACGTCAGCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014256.3-1385s21c1
Sequence:CCGGAGGTTTGATGAGTGAATATTCCTCGAGGAATATTCACTCATCAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014256
B3GNT3 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-1149s1c1
Sequence:CCGGCCGCTTCCTACCTTATGAGATCTCGAGATCTCATAAGGTAGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-702s1c1
Sequence:CCGGGCAGGAGACAAGGTGCGCCAACTCGAGTTGGCGCACCTTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-975s1c1
Sequence:CCGGTGCCCATGTCTTGGACATCTTCTCGAGAAGATGTCCAAGACATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-676s1c1
Sequence:CCGGCTCAAGCAGGTCCTGTTCTTACTCGAGTAAGAACAGGACCTGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014256.2-1212s1c1
Sequence:CCGGCGGCAATCAGACACAGATCTACTCGAGTAGATCTGTGTCTGATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014256.3-1698s21c1
Sequence:CCGGCATAGAGCTGACGTGAGAAATCTCGAGATTTCTCACGTCAGCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014256.3-1385s21c1
Sequence:CCGGAGGTTTGATGAGTGAATATTCCTCGAGGAATATTCACTCATCAAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028189
B3GNT3 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028189.2-1882s1c1
Sequence:CCGGCCTCTCTTTGACCTTCAATATCTCGAGATATTGAAGGTCAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-547s1c1
Sequence:CCGGCCCACAACAAGCACGCAAATACTCGAGTATTTGCGTGCTTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-672s1c1
Sequence:CCGGAGTGGCAGCTAACCTACTGTACTCGAGTACAGTAGGTTAGCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-276s1c1
Sequence:CCGGGAGCTAATCTATCCGTGTCCTCTCGAGAGGACACGGATAGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-590s1c1
Sequence:CCGGGCGCAGAAATACGGCGACATTCTCGAGAATGTCGCCGTATTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028189
B3GNT3 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028189.2-1882s1c1
Sequence:CCGGCCTCTCTTTGACCTTCAATATCTCGAGATATTGAAGGTCAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-547s1c1
Sequence:CCGGCCCACAACAAGCACGCAAATACTCGAGTATTTGCGTGCTTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-672s1c1
Sequence:CCGGAGTGGCAGCTAACCTACTGTACTCGAGTACAGTAGGTTAGCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-276s1c1
Sequence:CCGGGAGCTAATCTATCCGTGTCCTCTCGAGAGGACACGGATAGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-590s1c1
Sequence:CCGGGCGCAGAAATACGGCGACATTCTCGAGAATGTCGCCGTATTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028189
B3GNT3 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028189.2-1882s1c1
Sequence:CCGGCCTCTCTTTGACCTTCAATATCTCGAGATATTGAAGGTCAAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-547s1c1
Sequence:CCGGCCCACAACAAGCACGCAAATACTCGAGTATTTGCGTGCTTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-672s1c1
Sequence:CCGGAGTGGCAGCTAACCTACTGTACTCGAGTACAGTAGGTTAGCTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-276s1c1
Sequence:CCGGGAGCTAATCTATCCGTGTCCTCTCGAGAGGACACGGATAGATTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028189.2-590s1c1
Sequence:CCGGGCGCAGAAATACGGCGACATTCTCGAGAATGTCGCCGTATTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks