EMAIL THIS PAGE TO A FRIEND

B3GNT4

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4

50 Gene Product Result for
Synonyms: B3GN-T4 beta3Gn-T4
Gene ID:
Human(79369) Summary: This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase protein family. The encoded enzyme is involved in the biosynthesis of poly-N-acetyllactosamine chains and prefers lacto-N-neotetraose as a substrate. It is a type II transmembrane protein. [provided by RefSeq, Jul 2008]
Mouse(231727) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Rat(288752) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
naked mole-rat(101697436) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
sheep(101102267) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
chicken(100858043) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
dog(486255) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
domestic cat(101092795) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
cow(534619) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Horse(100060158) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030765 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030765 Rosetta Predictions human pricing
NM_001105938 Rosetta Predictions rat pricing
NM_198611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094049 predicted 509
2 SASI_Hs01_00094050 predicted 448
3 SASI_Hs02_00358298 predicted 1181
4 SASI_Hs01_00094051 predicted 520
5 SASI_Hs01_00094052 predicted 978
6 SASI_Hs02_00358299 predicted 458
7 SASI_Hs01_00094053 predicted 729
8 SASI_Hs01_00094054 predicted 850
9 SASI_Hs01_00094055 predicted 1006
10 SASI_Hs01_00094058 predicted 1085
11 SASI_Hs01_00094056 predicted 862
12 SASI_Hs01_00094057 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214022 predicted 294
2 SASI_Rn02_00214023 predicted 986
3 SASI_Rn02_00214024 predicted 253
4 SASI_Rn02_00214025 predicted 861
5 SASI_Rn02_00214026 predicted 1174
6 SASI_Rn02_00214027 predicted 781
7 SASI_Rn02_00214028 predicted 315
8 SASI_Rn02_00214029 predicted 467
9 SASI_Rn02_00214030 predicted 315
10 SASI_Rn02_00214031 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130880 predicted 305
2 SASI_Mm01_00130881 predicted 426
3 SASI_Mm01_00130882 predicted 230
4 SASI_Mm02_00351028 predicted 790
5 SASI_Mm02_00351029 predicted 580
6 SASI_Mm01_00130886 predicted 262
7 SASI_Mm02_00351030 predicted 789
8 SASI_Mm01_00130887 predicted 324
9 SASI_Mm01_00130888 predicted 542
10 SASI_Mm01_00130889 predicted 640
11 SASI_Mm01_00130883 predicted 852
12 SASI_Mm01_00130884 predicted 255
13 SASI_Mm01_00130885 predicted 699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030765
B3GNT4 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030765.2-1402s21c1
Sequence:CCAGCTATCGTGATGCGAAATTGATCTCGAGATCAATTTCGCATCACGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030765.2-1380s21c1
Sequence:CCGGGAGTGGACTCAGTGTTGATTCCTCGAGGAATCAACACTGAGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030765.2-556s21c1
Sequence:CCGGGCTGTTCCAAGGATACCTTCTCTCGAGAGAAGGTATCCTTGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-511s1c1
Sequence:CCGGCCTATCGTCACTGCCGAAATTCTCGAGAATTTCGGCAGTGACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-845s1c1
Sequence:CCGGCCAGGCCCATTTCATGCTAAACTCGAGTTTAGCATGAAATGGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-1095s1c1
Sequence:CCGGGCTATCATGGAAGATGCTGAACTCGAGTTCAGCATCTTCCATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-977s1c1
Sequence:CCGGCAGGAACACTAAGGTCAAATACTCGAGTATTTGACCTTAGTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-495s1c1
Sequence:CCGGCACCGTCTCTTCTTGACCTATCTCGAGATAGGTCAAGAAGAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030765
B3GNT4 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030765.2-1402s21c1
Sequence:CCAGCTATCGTGATGCGAAATTGATCTCGAGATCAATTTCGCATCACGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030765.2-1380s21c1
Sequence:CCGGGAGTGGACTCAGTGTTGATTCCTCGAGGAATCAACACTGAGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030765.2-556s21c1
Sequence:CCGGGCTGTTCCAAGGATACCTTCTCTCGAGAGAAGGTATCCTTGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-511s1c1
Sequence:CCGGCCTATCGTCACTGCCGAAATTCTCGAGAATTTCGGCAGTGACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-845s1c1
Sequence:CCGGCCAGGCCCATTTCATGCTAAACTCGAGTTTAGCATGAAATGGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-1095s1c1
Sequence:CCGGGCTATCATGGAAGATGCTGAACTCGAGTTCAGCATCTTCCATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-977s1c1
Sequence:CCGGCAGGAACACTAAGGTCAAATACTCGAGTATTTGACCTTAGTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-495s1c1
Sequence:CCGGCACCGTCTCTTCTTGACCTATCTCGAGATAGGTCAAGAAGAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030765
B3GNT4 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030765.2-1402s21c1
Sequence:CCAGCTATCGTGATGCGAAATTGATCTCGAGATCAATTTCGCATCACGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030765.2-1380s21c1
Sequence:CCGGGAGTGGACTCAGTGTTGATTCCTCGAGGAATCAACACTGAGTCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030765.2-556s21c1
Sequence:CCGGGCTGTTCCAAGGATACCTTCTCTCGAGAGAAGGTATCCTTGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-511s1c1
Sequence:CCGGCCTATCGTCACTGCCGAAATTCTCGAGAATTTCGGCAGTGACGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-845s1c1
Sequence:CCGGCCAGGCCCATTTCATGCTAAACTCGAGTTTAGCATGAAATGGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-1095s1c1
Sequence:CCGGGCTATCATGGAAGATGCTGAACTCGAGTTCAGCATCTTCCATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-977s1c1
Sequence:CCGGCAGGAACACTAAGGTCAAATACTCGAGTATTTGACCTTAGTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030765.2-495s1c1
Sequence:CCGGCACCGTCTCTTCTTGACCTATCTCGAGATAGGTCAAGAAGAGACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198611
B3GNT4 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198611.1-1219s1c1
Sequence:CCGGCCAGGAGAAACAATTCTGAAACTCGAGTTTCAGAATTGTTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-575s1c1
Sequence:CCGGGACATCTTACAGTGGGACTTTCTCGAGAAAGTCCCACTGTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-179s1c1
Sequence:CCGGCTCCTTCTGAAGGAACGCATACTCGAGTATGCGTTCCTTCAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-697s1c1
Sequence:CCGGCGTCTTTATCCATGTTCCCAACTCGAGTTGGGAACATGGATAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-317s1c1
Sequence:CCGGCGCCTCTTCTTAACCTATCGACTCGAGTCGATAGGTTAAGAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198611
B3GNT4 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198611.1-1219s1c1
Sequence:CCGGCCAGGAGAAACAATTCTGAAACTCGAGTTTCAGAATTGTTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-575s1c1
Sequence:CCGGGACATCTTACAGTGGGACTTTCTCGAGAAAGTCCCACTGTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-179s1c1
Sequence:CCGGCTCCTTCTGAAGGAACGCATACTCGAGTATGCGTTCCTTCAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-697s1c1
Sequence:CCGGCGTCTTTATCCATGTTCCCAACTCGAGTTGGGAACATGGATAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-317s1c1
Sequence:CCGGCGCCTCTTCTTAACCTATCGACTCGAGTCGATAGGTTAAGAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198611
B3GNT4 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198611.1-1219s1c1
Sequence:CCGGCCAGGAGAAACAATTCTGAAACTCGAGTTTCAGAATTGTTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-575s1c1
Sequence:CCGGGACATCTTACAGTGGGACTTTCTCGAGAAAGTCCCACTGTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-179s1c1
Sequence:CCGGCTCCTTCTGAAGGAACGCATACTCGAGTATGCGTTCCTTCAGAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-697s1c1
Sequence:CCGGCGTCTTTATCCATGTTCCCAACTCGAGTTGGGAACATGGATAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198611.1-317s1c1
Sequence:CCGGCGCCTCTTCTTAACCTATCGACTCGAGTCGATAGGTTAAGAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks