EMAIL THIS PAGE TO A FRIEND

B3GNT5

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5

145 Gene Product Result for
Synonyms: B3GN-T5 beta3Gn-T5
UniProtKB ID: Q9BYG0, D3DNS5, Q59FE3, Q7L9Z5, Q8WWP9
Gene ID:
Human(84002) Summary: This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
Mouse(108105) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Rat(116740) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
chicken(424960) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
cow(767899) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
domestic cat(101096409) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
sheep(101103203) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Domestic Rabbit(100352940) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
domestic guinea pig(100721740) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
naked mole-rat(101723270) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032047 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032047 Rosetta Predictions human pricing
XM_001060426 Rosetta Predictions rat pricing
XM_344040 Rosetta Predictions rat pricing
NM_054052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228622 predicted 911
2 SASI_Hs01_00228623 predicted 1070
3 SASI_Hs01_00228624 predicted 1636
4 SASI_Hs02_00359247 predicted 977
5 SASI_Hs02_00359248 predicted 1136
6 SASI_Hs01_00228626 predicted 1666
7 SASI_Hs01_00228628 predicted 657
8 SASI_Hs01_00228629 predicted 638
9 SASI_Hs01_00228630 predicted 1631
10 SASI_Hs01_00228631 predicted 1527
11 SASI_Hs01_00228625 predicted 1055
12 SASI_Hs01_00228627 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296474 predicted 426
2 SASI_Rn02_00296475 predicted 559
3 SASI_Rn02_00296476 predicted 584
4 SASI_Rn02_00296477 predicted 344
5 SASI_Rn02_00296478 predicted 777
6 SASI_Rn02_00296479 predicted 773
7 SASI_Rn02_00296480 predicted 822
8 SASI_Rn02_00296481 predicted 355
9 SASI_Rn02_00296482 predicted 479
10 SASI_Rn02_00296483 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344040 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396741 predicted 425
2 SASI_Rn02_00396742 predicted 567
3 SASI_Rn02_00396743 predicted 592
4 SASI_Rn02_00396744 predicted 348
5 SASI_Rn02_00396745 predicted 771
6 SASI_Rn02_00396746 predicted 772
7 SASI_Rn02_00396747 predicted 822
8 SASI_Rn02_00396748 predicted 349
9 SASI_Rn02_00396749 predicted 480
10 SASI_Rn02_00396750 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081120 predicted 1323
2 SASI_Mm01_00081121 predicted 1263
3 SASI_Mm01_00081122 predicted 1935
4 SASI_Mm01_00081123 predicted 1823
5 SASI_Mm01_00081124 predicted 1634
6 SASI_Mm01_00081125 predicted 1873
7 SASI_Mm01_00081126 predicted 966
8 SASI_Mm01_00081127 predicted 2025
9 SASI_Mm01_00081128 predicted 1418
10 SASI_Mm01_00081129 predicted 1681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054052
B3GNT5 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054052.2-2777s1c1
Sequence:CCGGGCAGCTTACAATGAGGAGTATCTCGAGATACTCCTCATTGTAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1377s1c1
Sequence:CCGGGCCAAATTCCTGATGACTGCTCTCGAGAGCAGTCATCAGGAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1815s1c1
Sequence:CCGGCTCTGGATAGAGGCTACACATCTCGAGATGTGTAGCCTCTATCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-961s1c1
Sequence:CCGGCCTACAGATACCTCGTAAATACTCGAGTATTTACGAGGTATCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1685s1c1
Sequence:CCGGCTGTGCCAATAAAGTGGGAATCTCGAGATTCCCACTTTATTGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054052.3-1780s21c1
Sequence:CCGGTGACATCTCACGGACACTTACCTCGAGGTAAGTGTCCGTGAGATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054052.3-2329s21c1
Sequence:CCGGGAACAAGCAATCCCAATTATCCTCGAGGATAATTGGGATTGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054052
B3GNT5 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054052.2-2777s1c1
Sequence:CCGGGCAGCTTACAATGAGGAGTATCTCGAGATACTCCTCATTGTAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1377s1c1
Sequence:CCGGGCCAAATTCCTGATGACTGCTCTCGAGAGCAGTCATCAGGAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1815s1c1
Sequence:CCGGCTCTGGATAGAGGCTACACATCTCGAGATGTGTAGCCTCTATCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-961s1c1
Sequence:CCGGCCTACAGATACCTCGTAAATACTCGAGTATTTACGAGGTATCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1685s1c1
Sequence:CCGGCTGTGCCAATAAAGTGGGAATCTCGAGATTCCCACTTTATTGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054052.3-1780s21c1
Sequence:CCGGTGACATCTCACGGACACTTACCTCGAGGTAAGTGTCCGTGAGATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054052.3-2329s21c1
Sequence:CCGGGAACAAGCAATCCCAATTATCCTCGAGGATAATTGGGATTGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054052
B3GNT5 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054052.2-2777s1c1
Sequence:CCGGGCAGCTTACAATGAGGAGTATCTCGAGATACTCCTCATTGTAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1377s1c1
Sequence:CCGGGCCAAATTCCTGATGACTGCTCTCGAGAGCAGTCATCAGGAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1815s1c1
Sequence:CCGGCTCTGGATAGAGGCTACACATCTCGAGATGTGTAGCCTCTATCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-961s1c1
Sequence:CCGGCCTACAGATACCTCGTAAATACTCGAGTATTTACGAGGTATCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054052.2-1685s1c1
Sequence:CCGGCTGTGCCAATAAAGTGGGAATCTCGAGATTCCCACTTTATTGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054052.3-1780s21c1
Sequence:CCGGTGACATCTCACGGACACTTACCTCGAGGTAAGTGTCCGTGAGATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054052.3-2329s21c1
Sequence:CCGGGAACAAGCAATCCCAATTATCCTCGAGGATAATTGGGATTGCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032047
VALIDATED
B3GNT5 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1286s1c1
Sequence:CCGGGCCTATGTAATCTCCGGTGATCTCGAGATCACCGGAGATTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032047.3-728s1c1
Sequence:CCGGCCTCGCTACCAATACTTGATTCTCGAGAATCAAGTATTGGTAGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-736s1c1
Sequence:CCGGCCAATACTTGATTAACCACAACTCGAGTTGTGGTTAATCAAGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1220s1c1
Sequence:CCGGAGCAAATACTACGTGTCCTATCTCGAGATAGGACACGTAGTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1511s1c1
Sequence:CCGGCTTTGGAAGAATGCTACAGATCTCGAGATCTGTAGCATTCTTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032047.4-832s21c1
Sequence:CCGGATGATCGACGTTCCGGAATTACTCGAGTAATTCCGGAACGTCGATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032047.4-2017s21c1
Sequence:CCGGTGAACGTACAGTACAACATTTCTCGAGAAATGTTGTACTGTACGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032047
VALIDATED
B3GNT5 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1286s1c1
Sequence:CCGGGCCTATGTAATCTCCGGTGATCTCGAGATCACCGGAGATTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032047.3-728s1c1
Sequence:CCGGCCTCGCTACCAATACTTGATTCTCGAGAATCAAGTATTGGTAGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-736s1c1
Sequence:CCGGCCAATACTTGATTAACCACAACTCGAGTTGTGGTTAATCAAGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1220s1c1
Sequence:CCGGAGCAAATACTACGTGTCCTATCTCGAGATAGGACACGTAGTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1511s1c1
Sequence:CCGGCTTTGGAAGAATGCTACAGATCTCGAGATCTGTAGCATTCTTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032047.4-832s21c1
Sequence:CCGGATGATCGACGTTCCGGAATTACTCGAGTAATTCCGGAACGTCGATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032047.4-2017s21c1
Sequence:CCGGTGAACGTACAGTACAACATTTCTCGAGAAATGTTGTACTGTACGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032047
VALIDATED
B3GNT5 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1286s1c1
Sequence:CCGGGCCTATGTAATCTCCGGTGATCTCGAGATCACCGGAGATTACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032047.3-728s1c1
Sequence:CCGGCCTCGCTACCAATACTTGATTCTCGAGAATCAAGTATTGGTAGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-736s1c1
Sequence:CCGGCCAATACTTGATTAACCACAACTCGAGTTGTGGTTAATCAAGTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1220s1c1
Sequence:CCGGAGCAAATACTACGTGTCCTATCTCGAGATAGGACACGTAGTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032047.3-1511s1c1
Sequence:CCGGCTTTGGAAGAATGCTACAGATCTCGAGATCTGTAGCATTCTTCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032047.4-832s21c1
Sequence:CCGGATGATCGACGTTCCGGAATTACTCGAGTAATTCCGGAACGTCGATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032047.4-2017s21c1
Sequence:CCGGTGAACGTACAGTACAACATTTCTCGAGAAATGTTGTACTGTACGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)