EMAIL THIS PAGE TO A FRIEND

B3GNT6

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)

Synonyms: B3Gn-T6 BGnT-6 beta-1,3-Gn-T6 beta3Gn-T6
UniProtKB ID: Q6ZMB0, E9PKS1, Q6ZSC5, Q8TAZ4, Q8TDX1
Gene ID:
Mouse(272411) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Rat(292325) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
chicken(100859103) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
dog(485176) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
cow(540848) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
domestic cat(101088357) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
cow(786615) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
naked mole-rat(101709961) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
domestic guinea pig(100734343) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
sheep(101110268) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172201 MISSION® esiRNA esiRNA targeting mouse B3gnt6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138706 Rosetta Predictions human pricing
NM_001106211 Rosetta Predictions rat pricing
NM_001081167 Rosetta Predictions mouse pricing
XM_195661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363811 predicted 304
2 SASI_Hs02_00363812 predicted 292
3 SASI_Hs01_00164080 predicted 1162
4 SASI_Hs01_00164077 predicted 1729
5 SASI_Hs01_00164078 predicted 674
6 SASI_Hs01_00164083 predicted 1267
7 SASI_Hs01_00164084 predicted 757
8 SASI_Hs01_00164085 predicted 1665
9 SASI_Hs02_00363813 predicted 1680
10 SASI_Hs01_00164082 predicted 1665
11 SASI_Hs01_00164076 predicted 363
12 SASI_Hs01_00164079 predicted 516
13 SASI_Hs01_00164081 predicted 1641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216728 predicted 904
2 SASI_Rn02_00216729 predicted 790
3 SASI_Rn02_00216730 predicted 1025
4 SASI_Rn02_00216731 predicted 943
5 SASI_Rn02_00216732 predicted 689
6 SASI_Rn02_00216733 predicted 1308
7 SASI_Rn02_00216734 predicted 1346
8 SASI_Rn02_00216735 predicted 412
9 SASI_Rn02_00216736 predicted 773
10 SASI_Rn02_00216737 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295841 predicted 1218
2 SASI_Mm02_00295842 predicted 1028
3 SASI_Mm02_00295843 predicted 1341
4 SASI_Mm02_00295844 predicted 1093
5 SASI_Mm02_00295845 predicted 1533
6 SASI_Mm02_00295846 predicted 779
7 SASI_Mm02_00295847 predicted 1501
8 SASI_Mm02_00295848 predicted 746
9 SASI_Mm02_00295849 predicted 579
10 SASI_Mm02_00295850 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_195661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257525 predicted 865
2 SASI_Mm01_00257526 predicted 1218
3 SASI_Mm01_00257527 predicted 1032
4 SASI_Mm01_00257528 predicted 1352
5 SASI_Mm01_00257529 predicted 1093
6 SASI_Mm01_00257530 predicted 789
7 SASI_Mm01_00257531 predicted 869
8 SASI_Mm01_00257532 predicted 745
9 SASI_Mm01_00257533 predicted 591
10 SASI_Mm01_00257534 predicted 766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081167
B3GNT6 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-774s21c1
Sequence:CCGGTTCTGTGCCTGTTCGCGAAAGCTCGAGCTTTCGCGAACAGGCACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-95s21c1
Sequence:CCGGTGACTTTAGTGGTGCTGAATCCTCGAGGATTCAGCACCACTAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081167.1-1796s21c1
Sequence:CCGGAGGTCTCACCACCGGGTTAATCTCGAGATTAACCCGGTGGTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-1022s21c1
Sequence:CCGGTGCCCAATGTGCAGCGCTTATCTCGAGATAAGCGCTGCACATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081167
B3GNT6 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-774s21c1
Sequence:CCGGTTCTGTGCCTGTTCGCGAAAGCTCGAGCTTTCGCGAACAGGCACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-95s21c1
Sequence:CCGGTGACTTTAGTGGTGCTGAATCCTCGAGGATTCAGCACCACTAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081167.1-1796s21c1
Sequence:CCGGAGGTCTCACCACCGGGTTAATCTCGAGATTAACCCGGTGGTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-1022s21c1
Sequence:CCGGTGCCCAATGTGCAGCGCTTATCTCGAGATAAGCGCTGCACATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081167
B3GNT6 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-774s21c1
Sequence:CCGGTTCTGTGCCTGTTCGCGAAAGCTCGAGCTTTCGCGAACAGGCACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-95s21c1
Sequence:CCGGTGACTTTAGTGGTGCTGAATCCTCGAGGATTCAGCACCACTAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081167.1-1796s21c1
Sequence:CCGGAGGTCTCACCACCGGGTTAATCTCGAGATTAACCCGGTGGTGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081167.1-1022s21c1
Sequence:CCGGTGCCCAATGTGCAGCGCTTATCTCGAGATAAGCGCTGCACATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138706
B3GNT6 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-567s1c1
Sequence:CCGGCTTCGCGGACACCTTCCTCAACTCGAGTTGAGGAAGGTGTCCGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-927s1c1
Sequence:CCGGCGCCTACATGGGCATGTGTCTCTCGAGAGACACATGCCCATGTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-816s1c1
Sequence:CCGGCGGGTCCGCTTACCCGGTGTACTCGAGTACACCGGGTAAGCGGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-455s1c1
Sequence:CCGGGCCGCCTCTTTCTATTGGGCACTCGAGTGCCCAATAGAAAGAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-60s1c1
Sequence:CCGGCGTGAGTTTCTTAGCACTGCACTCGAGTGCAGTGCTAAGAAACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138706
B3GNT6 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-567s1c1
Sequence:CCGGCTTCGCGGACACCTTCCTCAACTCGAGTTGAGGAAGGTGTCCGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-927s1c1
Sequence:CCGGCGCCTACATGGGCATGTGTCTCTCGAGAGACACATGCCCATGTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-816s1c1
Sequence:CCGGCGGGTCCGCTTACCCGGTGTACTCGAGTACACCGGGTAAGCGGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-455s1c1
Sequence:CCGGGCCGCCTCTTTCTATTGGGCACTCGAGTGCCCAATAGAAAGAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-60s1c1
Sequence:CCGGCGTGAGTTTCTTAGCACTGCACTCGAGTGCAGTGCTAAGAAACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138706
B3GNT6 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-567s1c1
Sequence:CCGGCTTCGCGGACACCTTCCTCAACTCGAGTTGAGGAAGGTGTCCGCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-927s1c1
Sequence:CCGGCGCCTACATGGGCATGTGTCTCTCGAGAGACACATGCCCATGTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-816s1c1
Sequence:CCGGCGGGTCCGCTTACCCGGTGTACTCGAGTACACCGGGTAAGCGGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-455s1c1
Sequence:CCGGGCCGCCTCTTTCTATTGGGCACTCGAGTGCCCAATAGAAAGAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138706.1-60s1c1
Sequence:CCGGCGTGAGTTTCTTAGCACTGCACTCGAGTGCAGTGCTAAGAAACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks