EMAIL THIS PAGE TO A FRIEND

B3GNT7

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7

Synonyms: beta3GnT7
UniProtKB ID: Q8NFL0, B3KWY4, B7WNP0
Gene ID:
Mouse(227327) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Rat(316583) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
sheep(101107579) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Domestic Rabbit(100342627) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
domestic guinea pig(100735674) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
naked mole-rat(101700902) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Zebrafish(286748) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
chicken(424930) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
cow(538799) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
domestic cat(101082589) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
dog(486158) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145236 Rosetta Predictions human pricing
NM_001012134 Rosetta Predictions rat pricing
XM_001081910 Rosetta Predictions rat pricing
XM_576606 Rosetta Predictions rat pricing
NM_145222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365075 predicted 994
2 SASI_Hs01_00143430 predicted 769
3 SASI_Hs02_00365076 predicted 992
4 SASI_Hs01_00143431 predicted 918
5 SASI_Hs01_00143433 predicted 428
6 SASI_Hs01_00143434 predicted 582
7 SASI_Hs01_00143435 predicted 1208
8 SASI_Hs01_00143436 predicted 768
9 SASI_Hs01_00143438 predicted 801
10 SASI_Hs01_00143439 predicted 926
11 SASI_Hs01_00143432 predicted 579
12 SASI_Hs01_00143437 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043007 predicted 1309
2 SASI_Rn01_00043008 predicted 1367
3 SASI_Rn01_00043009 predicted 607
4 SASI_Rn01_00043011 predicted 527
5 SASI_Rn01_00043012 predicted 1530
6 SASI_Rn01_00043013 predicted 1052
7 SASI_Rn01_00043014 predicted 518
8 SASI_Rn01_00043015 predicted 679
9 SASI_Rn02_00200303 predicted 853
10 SASI_Rn02_00200304 predicted 602
11 SASI_Rn01_00043010 predicted 988
12 SASI_Rn01_00043016 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374046 predicted 1030
2 SASI_Rn02_00374047 predicted 1105
3 SASI_Rn02_00374048 predicted 341
4 SASI_Rn02_00374049 predicted 1472
5 SASI_Rn02_00374050 predicted 258
6 SASI_Rn02_00374051 predicted 1254
7 SASI_Rn02_00374052 predicted 780
8 SASI_Rn02_00374053 predicted 247
9 SASI_Rn02_00374054 predicted 413
10 SASI_Rn02_00374055 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155047 predicted 1307
2 SASI_Rn01_00155048 predicted 1378
3 SASI_Rn01_00155049 predicted 618
4 SASI_Rn01_00155050 predicted 989
5 SASI_Rn01_00155051 predicted 530
6 SASI_Rn01_00155052 predicted 1532
7 SASI_Rn01_00155053 predicted 1055
8 SASI_Rn01_00155054 predicted 527
9 SASI_Rn01_00155055 predicted 688
10 SASI_Rn01_00155056 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090976 predicted 317
2 SASI_Mm01_00090978 predicted 311
3 SASI_Mm02_00340599 predicted 1226
4 SASI_Mm01_00090979 predicted 1543
5 SASI_Mm01_00090980 predicted 385
6 SASI_Mm01_00090981 predicted 1150
7 SASI_Mm02_00340600 predicted 255
8 SASI_Mm01_00090982 predicted 1234
9 SASI_Mm01_00090983 predicted 439
10 SASI_Mm01_00090984 predicted 469
11 SASI_Mm01_00090977 predicted 851
12 SASI_Mm01_00090985 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145236
B3GNT7 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-438s1c1
Sequence:CCGGCACTAACTGCTCAGCCAATATCTCGAGATATTGGCTGAGCAGTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-1002s1c1
Sequence:CCGGCATTCGCAGGAAAGACAACAACTCGAGTTGTTGTCTTTCCTGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-446s1c1
Sequence:CCGGGCTCAGCCAATATCAACTTGACTCGAGTCAAGTTGATATTGGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-357s1c1
Sequence:CCGGCAACTTCTGGAAGAACCCGAACTCGAGTTCGGGTTCTTCCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-1217s1c1
Sequence:CCGGGCTTCAAGACTTTCGGCATCTCTCGAGAGATGCCGAAAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145236.2-591s21c1
Sequence:CCGGGGTGGTTGTCAAGTCGGTCATCTCGAGATGACCGACTTGACAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145236.2-1550s21c1
Sequence:CCGGGGACCTCCCTGTGTGGATAATCTCGAGATTATCCACACAGGGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145236.2-922s21c1
Sequence:CCGGACCAACCTGCTAGAATTTCTGCTCGAGCAGAAATTCTAGCAGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145236
B3GNT7 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-438s1c1
Sequence:CCGGCACTAACTGCTCAGCCAATATCTCGAGATATTGGCTGAGCAGTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-1002s1c1
Sequence:CCGGCATTCGCAGGAAAGACAACAACTCGAGTTGTTGTCTTTCCTGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-446s1c1
Sequence:CCGGGCTCAGCCAATATCAACTTGACTCGAGTCAAGTTGATATTGGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-357s1c1
Sequence:CCGGCAACTTCTGGAAGAACCCGAACTCGAGTTCGGGTTCTTCCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-1217s1c1
Sequence:CCGGGCTTCAAGACTTTCGGCATCTCTCGAGAGATGCCGAAAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145236.2-591s21c1
Sequence:CCGGGGTGGTTGTCAAGTCGGTCATCTCGAGATGACCGACTTGACAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145236.2-1550s21c1
Sequence:CCGGGGACCTCCCTGTGTGGATAATCTCGAGATTATCCACACAGGGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145236.2-922s21c1
Sequence:CCGGACCAACCTGCTAGAATTTCTGCTCGAGCAGAAATTCTAGCAGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145236
B3GNT7 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-438s1c1
Sequence:CCGGCACTAACTGCTCAGCCAATATCTCGAGATATTGGCTGAGCAGTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-1002s1c1
Sequence:CCGGCATTCGCAGGAAAGACAACAACTCGAGTTGTTGTCTTTCCTGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-446s1c1
Sequence:CCGGGCTCAGCCAATATCAACTTGACTCGAGTCAAGTTGATATTGGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-357s1c1
Sequence:CCGGCAACTTCTGGAAGAACCCGAACTCGAGTTCGGGTTCTTCCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145236.1-1217s1c1
Sequence:CCGGGCTTCAAGACTTTCGGCATCTCTCGAGAGATGCCGAAAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145236.2-591s21c1
Sequence:CCGGGGTGGTTGTCAAGTCGGTCATCTCGAGATGACCGACTTGACAACCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145236.2-1550s21c1
Sequence:CCGGGGACCTCCCTGTGTGGATAATCTCGAGATTATCCACACAGGGAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145236.2-922s21c1
Sequence:CCGGACCAACCTGCTAGAATTTCTGCTCGAGCAGAAATTCTAGCAGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145222
B3GNT7 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145222.1-2051s1c1
Sequence:CCGGGCCCTAGATGTAGACATTCTTCTCGAGAAGAATGTCTACATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-403s1c1
Sequence:CCGGCTATCGGCATTGCCGGTATTTCTCGAGAAATACCGGCAATGCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-316s1c1
Sequence:CCGGGATCACCACTAACTGCTCTATCTCGAGATAGAGCAGTTAGTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-916s1c1
Sequence:CCGGCCCAGCCGTCATGTATGGTAACTCGAGTTACCATACATGACGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-1227s1c1
Sequence:CCGGTGCATAGCAATCTTACCTGTTCTCGAGAACAGGTAAGATTGCTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145222.2-1775s21c1
Sequence:CCGCGTGGACTCTAAAGGAACATTTCTCGAGAAATGTTCCTTTAGAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145222.2-420s21c1
Sequence:CCGGCAATTCCTTCAGGATCCTTTACTCGAGTAAAGGATCCTGAAGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145222
B3GNT7 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145222.1-2051s1c1
Sequence:CCGGGCCCTAGATGTAGACATTCTTCTCGAGAAGAATGTCTACATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-403s1c1
Sequence:CCGGCTATCGGCATTGCCGGTATTTCTCGAGAAATACCGGCAATGCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-316s1c1
Sequence:CCGGGATCACCACTAACTGCTCTATCTCGAGATAGAGCAGTTAGTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-916s1c1
Sequence:CCGGCCCAGCCGTCATGTATGGTAACTCGAGTTACCATACATGACGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-1227s1c1
Sequence:CCGGTGCATAGCAATCTTACCTGTTCTCGAGAACAGGTAAGATTGCTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145222.2-1775s21c1
Sequence:CCGCGTGGACTCTAAAGGAACATTTCTCGAGAAATGTTCCTTTAGAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145222.2-420s21c1
Sequence:CCGGCAATTCCTTCAGGATCCTTTACTCGAGTAAAGGATCCTGAAGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145222
B3GNT7 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145222.1-2051s1c1
Sequence:CCGGGCCCTAGATGTAGACATTCTTCTCGAGAAGAATGTCTACATCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-403s1c1
Sequence:CCGGCTATCGGCATTGCCGGTATTTCTCGAGAAATACCGGCAATGCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-316s1c1
Sequence:CCGGGATCACCACTAACTGCTCTATCTCGAGATAGAGCAGTTAGTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-916s1c1
Sequence:CCGGCCCAGCCGTCATGTATGGTAACTCGAGTTACCATACATGACGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145222.1-1227s1c1
Sequence:CCGGTGCATAGCAATCTTACCTGTTCTCGAGAACAGGTAAGATTGCTATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145222.2-1775s21c1
Sequence:CCGCGTGGACTCTAAAGGAACATTTCTCGAGAAATGTTCCTTTAGAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145222.2-420s21c1
Sequence:CCGGCAATTCCTTCAGGATCCTTTACTCGAGTAAAGGATCCTGAAGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks