EMAIL THIS PAGE TO A FRIEND

B3GNT8

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8

54 Gene Product Result for
Synonyms: B3GALT7 BGALT15 beta3Gn-T8
UniProtKB ID: Q7Z7M8
Gene ID:
Mouse(232984) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Rat(308440) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
chicken(431084) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
dog(484487) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
cow(534859) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
domestic cat(101086935) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
naked mole-rat(101706506) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
domestic guinea pig(100715465) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
sheep(101123400) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198540 Rosetta Predictions human pricing
NM_001107492 Rosetta Predictions rat pricing
NM_001036740 Rosetta Predictions mouse pricing
NM_146184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240052 predicted 1601
2 SASI_Hs01_00240053 predicted 1256
3 SASI_Hs02_00372146 predicted 494
4 SASI_Hs01_00240054 predicted 1258
5 SASI_Hs01_00240055 predicted 642
6 SASI_Hs01_00240056 predicted 903
7 SASI_Hs01_00240057 predicted 1102
8 SASI_Hs01_00240058 predicted 1630
9 SASI_Hs01_00240059 predicted 974
10 SASI_Hs01_00240060 predicted 1607
11 SASI_Hs01_00240061 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229365 predicted 1075
2 SASI_Rn02_00229366 predicted 1264
3 SASI_Rn02_00229367 predicted 1197
4 SASI_Rn02_00229368 predicted 824
5 SASI_Rn02_00229369 predicted 1240
6 SASI_Rn02_00229370 predicted 905
7 SASI_Rn02_00229371 predicted 1034
8 SASI_Rn02_00229372 predicted 972
9 SASI_Rn02_00229373 predicted 1072
10 SASI_Rn02_00229374 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001036740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092536 predicted 1244
2 SASI_Mm01_00092537 predicted 724
3 SASI_Mm01_00092538 predicted 683
4 SASI_Mm02_00289276 predicted 720
5 SASI_Mm01_00092539 predicted 554
6 SASI_Mm01_00092540 predicted 362
7 SASI_Mm01_00092541 predicted 315
8 SASI_Mm01_00092542 predicted 751
9 SASI_Mm01_00092543 predicted 911
10 SASI_Mm01_00092544 predicted 331
11 SASI_Mm01_00092545 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052992 predicted 1629
2 SASI_Mm01_00052993 predicted 1117
3 SASI_Mm01_00052994 predicted 1075
4 SASI_Mm02_00341882 predicted 1108
5 SASI_Mm01_00052995 predicted 947
6 SASI_Mm01_00052996 predicted 754
7 SASI_Mm01_00052997 predicted 715
8 SASI_Mm01_00052998 predicted 1150
9 SASI_Mm01_00052999 predicted 1307
10 SASI_Mm01_00053000 predicted 719
11 SASI_Mm01_00053001 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198540
B3GNT8 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198540.2-1637s21c1
Sequence:CCGGCTCCAGTGCTGACTCTCATTGCTCGAGCAATGAGAGTCAGCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198540.2-1452s21c1
Sequence:CCGGAGGACGTCTACACTGGCCTTTCTCGAGAAAGGCCAGTGTAGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1105s1c1
Sequence:CCGGCCCATTCAACCAGACGCTCAACTCGAGTTGAGCGTCTGGTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-661s1c1
Sequence:CCGGCTTTGCTTACTGGAACCAGCACTCGAGTGCTGGTTCCAGTAAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1184s1c1
Sequence:CCGGCGAGCTCAGGACGATGCCTTTCTCGAGAAAGGCATCGTCCTGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1603s1c1
Sequence:CCGGCATTCGGCTCTGGAAACAACTCTCGAGAGTTGTTTCCAGAGCCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-502s1c1
Sequence:CCGGCCTGGGCCTCAAAGTGTACATCTCGAGATGTACACTTTGAGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198540
B3GNT8 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198540.2-1637s21c1
Sequence:CCGGCTCCAGTGCTGACTCTCATTGCTCGAGCAATGAGAGTCAGCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198540.2-1452s21c1
Sequence:CCGGAGGACGTCTACACTGGCCTTTCTCGAGAAAGGCCAGTGTAGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1105s1c1
Sequence:CCGGCCCATTCAACCAGACGCTCAACTCGAGTTGAGCGTCTGGTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-661s1c1
Sequence:CCGGCTTTGCTTACTGGAACCAGCACTCGAGTGCTGGTTCCAGTAAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1184s1c1
Sequence:CCGGCGAGCTCAGGACGATGCCTTTCTCGAGAAAGGCATCGTCCTGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1603s1c1
Sequence:CCGGCATTCGGCTCTGGAAACAACTCTCGAGAGTTGTTTCCAGAGCCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-502s1c1
Sequence:CCGGCCTGGGCCTCAAAGTGTACATCTCGAGATGTACACTTTGAGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198540
B3GNT8 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198540.2-1637s21c1
Sequence:CCGGCTCCAGTGCTGACTCTCATTGCTCGAGCAATGAGAGTCAGCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198540.2-1452s21c1
Sequence:CCGGAGGACGTCTACACTGGCCTTTCTCGAGAAAGGCCAGTGTAGACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1105s1c1
Sequence:CCGGCCCATTCAACCAGACGCTCAACTCGAGTTGAGCGTCTGGTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-661s1c1
Sequence:CCGGCTTTGCTTACTGGAACCAGCACTCGAGTGCTGGTTCCAGTAAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1184s1c1
Sequence:CCGGCGAGCTCAGGACGATGCCTTTCTCGAGAAAGGCATCGTCCTGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-1603s1c1
Sequence:CCGGCATTCGGCTCTGGAAACAACTCTCGAGAGTTGTTTCCAGAGCCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198540.2-502s1c1
Sequence:CCGGCCTGGGCCTCAAAGTGTACATCTCGAGATGTACACTTTGAGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146184
B3GNT8 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-796s21c1
Sequence:CCGGTGTTGCTGCCTCGGAGATCTTCTCGAGAAGATCTCCGAGGCAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-1409s21c1
Sequence:CCGGTATGCGAGTGGAGGTGGCTATCTCGAGATAGCCACCTCCACTCGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-770s21c1
Sequence:CCGGAGTACGGACTGTCAGACTTGGCTCGAGCCAAGTCTGACAGTCCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-599s21c1
Sequence:CCGGACATCCGAGTCCTGGCTTAAACTCGAGTTTAAGCCAGGACTCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146184.2-1681s1c1
Sequence:CCGGCAGAGACAAGCTGGGGTGGGTCTCGAGACCCACCCCAGCTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-554s1c1
Sequence:CCGGCCTGGGCCTCAAAGTATACATCTCGAGATGTATACTTTGAGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-1478s1c1
Sequence:CCGGTGATGATGTCTACACTGGCTTCTCGAGAAGCCAGTGTAGACATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-928s1c1
Sequence:CCGGACTTGCTACTGGCTGTCAAATCTCGAGATTTGACAGCCAGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-1058s1c1
Sequence:CCGGGCCTGACTTAAGATCACTGGTCTCGAGACCAGTGATCTTAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146184
B3GNT8 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-796s21c1
Sequence:CCGGTGTTGCTGCCTCGGAGATCTTCTCGAGAAGATCTCCGAGGCAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-1409s21c1
Sequence:CCGGTATGCGAGTGGAGGTGGCTATCTCGAGATAGCCACCTCCACTCGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-770s21c1
Sequence:CCGGAGTACGGACTGTCAGACTTGGCTCGAGCCAAGTCTGACAGTCCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-599s21c1
Sequence:CCGGACATCCGAGTCCTGGCTTAAACTCGAGTTTAAGCCAGGACTCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146184.2-1681s1c1
Sequence:CCGGCAGAGACAAGCTGGGGTGGGTCTCGAGACCCACCCCAGCTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-554s1c1
Sequence:CCGGCCTGGGCCTCAAAGTATACATCTCGAGATGTATACTTTGAGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-1478s1c1
Sequence:CCGGTGATGATGTCTACACTGGCTTCTCGAGAAGCCAGTGTAGACATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-928s1c1
Sequence:CCGGACTTGCTACTGGCTGTCAAATCTCGAGATTTGACAGCCAGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-1058s1c1
Sequence:CCGGGCCTGACTTAAGATCACTGGTCTCGAGACCAGTGATCTTAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146184
B3GNT8 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-796s21c1
Sequence:CCGGTGTTGCTGCCTCGGAGATCTTCTCGAGAAGATCTCCGAGGCAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-1409s21c1
Sequence:CCGGTATGCGAGTGGAGGTGGCTATCTCGAGATAGCCACCTCCACTCGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-770s21c1
Sequence:CCGGAGTACGGACTGTCAGACTTGGCTCGAGCCAAGTCTGACAGTCCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146184.4-599s21c1
Sequence:CCGGACATCCGAGTCCTGGCTTAAACTCGAGTTTAAGCCAGGACTCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146184.2-1681s1c1
Sequence:CCGGCAGAGACAAGCTGGGGTGGGTCTCGAGACCCACCCCAGCTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-554s1c1
Sequence:CCGGCCTGGGCCTCAAAGTATACATCTCGAGATGTATACTTTGAGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-1478s1c1
Sequence:CCGGTGATGATGTCTACACTGGCTTCTCGAGAAGCCAGTGTAGACATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-928s1c1
Sequence:CCGGACTTGCTACTGGCTGTCAAATCTCGAGATTTGACAGCCAGTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146184.2-1058s1c1
Sequence:CCGGGCCTGACTTAAGATCACTGGTCTCGAGACCAGTGATCTTAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks