EMAIL THIS PAGE TO A FRIEND

B3GNT9

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9

65 Gene Product Result for
UniProtKB ID: Q6UX72, Q96EK0
Gene ID:
Mouse(97440) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Rat(291958) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
sheep(101111309) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
domestic guinea pig(100713569) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
naked mole-rat(101722635) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Zebrafish(100034499) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
chicken(427539) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
dog(489767) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
cow(614717) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
domestic cat(101097530) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033309 Rosetta Predictions human pricing
XM_001075431 Rosetta Predictions rat pricing
XM_226431 Rosetta Predictions rat pricing
NM_178879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238025 predicted 601
2 SASI_Hs02_00361148 predicted 557
3 SASI_Hs01_00238026 predicted 1700
4 SASI_Hs01_00238027 predicted 1567
5 SASI_Hs01_00238028 predicted 1782
6 SASI_Hs01_00238029 predicted 1074
7 SASI_Hs02_00361149 predicted 1698
8 SASI_Hs01_00238030 predicted 1556
9 SASI_Hs01_00238031 predicted 1685
10 SASI_Hs01_00238032 predicted 1692
11 SASI_Hs01_00238033 predicted 1793
12 SASI_Hs01_00238034 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349703 predicted 364
2 SASI_Rn02_00349704 predicted 214
3 SASI_Rn02_00349705 predicted 383
4 SASI_Rn02_00349706 predicted 946
5 SASI_Rn02_00349707 predicted 765
6 SASI_Rn02_00349708 predicted 581
7 SASI_Rn02_00349709 predicted 848
8 SASI_Rn02_00349710 predicted 365
9 SASI_Rn02_00349711 predicted 945
10 SASI_Rn02_00349712 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383556 predicted 600
2 SASI_Rn01_00140473 predicted 439
3 SASI_Rn02_00383557 predicted 614
4 SASI_Rn02_00383558 predicted 1180
5 SASI_Rn02_00383559 predicted 988
6 SASI_Rn02_00383560 predicted 807
7 SASI_Rn02_00383561 predicted 1084
8 SASI_Rn02_00383562 predicted 596
9 SASI_Rn02_00383563 predicted 1175
10 SASI_Rn02_00383564 predicted 983
11 SASI_Rn01_00140472 predicted 394
12 SASI_Rn01_00140474 predicted 283
13 SASI_Rn01_00140475 predicted 259
14 SASI_Rn01_00140476 predicted 509
15 SASI_Rn01_00140477 predicted 248
16 SASI_Rn01_00140478 predicted 337
17 SASI_Rn01_00140479 predicted 559
18 SASI_Rn01_00140480 predicted 292
19 SASI_Rn01_00140481 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128059 predicted 1414
2 SASI_Mm01_00128060 predicted 819
3 SASI_Mm01_00128061 predicted 1483
4 SASI_Mm01_00128062 predicted 1041
5 SASI_Mm01_00128063 predicted 1026
6 SASI_Mm01_00128064 predicted 1274
7 SASI_Mm01_00128065 predicted 1117
8 SASI_Mm02_00349464 predicted 452
9 SASI_Mm01_00128066 predicted 1137
10 SASI_Mm01_00128068 predicted 504
11 SASI_Mm01_00128067 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178879
B3GNT9 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178879.2-2044s1c1
Sequence:CCGGCCACTATAAGATTGCTCATATCTCGAGATATGAGCAATCTTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1466s1c1
Sequence:CCGGCGAGAACTGGTGGTAGTACATCTCGAGATGTACTACCACCAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1430s1c1
Sequence:CCGGGCACCTCATCTTCGAACCTTTCTCGAGAAAGGTTCGAAGATGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1298s1c1
Sequence:CCGGGCTGATGCTTGCTCACAAGTTCTCGAGAACTTGTGAGCAAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-701s1c1
Sequence:CCGGCTCATTAACCAGCGTCGCAAACTCGAGTTTGCGACGCTGGTTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178879.3-814s21c1
Sequence:CCGGCGCTGAAGGAGATTCACTTTCCTCGAGGAAAGTGAATCTCCTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178879.3-1029s21c1
Sequence:CCGGGTGTATGGACTGCCCGTTTACCTCGAGGTAAACGGGCAGTCCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178879.3-1685s21c1
Sequence:CCGGCTGGTGTTAGAGCTAACTAAGCTCGAGCTTAGTTAGCTCTAACACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178879.3-1756s21c1
Sequence:CCGGTCACCGTCTTGCCCACTATACCTCGAGGTATAGTGGGCAAGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178879
B3GNT9 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178879.2-2044s1c1
Sequence:CCGGCCACTATAAGATTGCTCATATCTCGAGATATGAGCAATCTTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1466s1c1
Sequence:CCGGCGAGAACTGGTGGTAGTACATCTCGAGATGTACTACCACCAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1430s1c1
Sequence:CCGGGCACCTCATCTTCGAACCTTTCTCGAGAAAGGTTCGAAGATGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1298s1c1
Sequence:CCGGGCTGATGCTTGCTCACAAGTTCTCGAGAACTTGTGAGCAAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-701s1c1
Sequence:CCGGCTCATTAACCAGCGTCGCAAACTCGAGTTTGCGACGCTGGTTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178879.3-814s21c1
Sequence:CCGGCGCTGAAGGAGATTCACTTTCCTCGAGGAAAGTGAATCTCCTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178879.3-1029s21c1
Sequence:CCGGGTGTATGGACTGCCCGTTTACCTCGAGGTAAACGGGCAGTCCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178879.3-1685s21c1
Sequence:CCGGCTGGTGTTAGAGCTAACTAAGCTCGAGCTTAGTTAGCTCTAACACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178879.3-1756s21c1
Sequence:CCGGTCACCGTCTTGCCCACTATACCTCGAGGTATAGTGGGCAAGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178879
B3GNT9 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178879.2-2044s1c1
Sequence:CCGGCCACTATAAGATTGCTCATATCTCGAGATATGAGCAATCTTATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1466s1c1
Sequence:CCGGCGAGAACTGGTGGTAGTACATCTCGAGATGTACTACCACCAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1430s1c1
Sequence:CCGGGCACCTCATCTTCGAACCTTTCTCGAGAAAGGTTCGAAGATGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-1298s1c1
Sequence:CCGGGCTGATGCTTGCTCACAAGTTCTCGAGAACTTGTGAGCAAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178879.2-701s1c1
Sequence:CCGGCTCATTAACCAGCGTCGCAAACTCGAGTTTGCGACGCTGGTTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178879.3-814s21c1
Sequence:CCGGCGCTGAAGGAGATTCACTTTCCTCGAGGAAAGTGAATCTCCTTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178879.3-1029s21c1
Sequence:CCGGGTGTATGGACTGCCCGTTTACCTCGAGGTAAACGGGCAGTCCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178879.3-1685s21c1
Sequence:CCGGCTGGTGTTAGAGCTAACTAAGCTCGAGCTTAGTTAGCTCTAACACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178879.3-1756s21c1
Sequence:CCGGTCACCGTCTTGCCCACTATACCTCGAGGTATAGTGGGCAAGACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033309
B3GNT9 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033309.1-596s1c1
Sequence:CCGGGTTTCCACTGCTCATTAACCACTCGAGTGGTTAATGAGCAGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033309.1-927s1c1
Sequence:CCGGCTCAAGGAGATCCACTTTCTACTCGAGTAGAAAGTGGATCTCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033309.1-2530s1c1
Sequence:CCGGCCCTGCACATTCATCATTAAACTCGAGTTTAATGATGAATGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033309.1-2475s1c1
Sequence:CCGGGCCACACAAACCTGGCTATAACTCGAGTTATAGCCAGGTTTGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-1016s21c1
Sequence:CCGGTGTTCGTGAACGTGGGAAATCCTCGAGGATTTCCCACGTTCACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-669s21c1
Sequence:CCGGGGACCTGCTTATTGCTGTCAACTCGAGTTGACAGCAATAAGCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-1076s21c1
Sequence:CCGGTGCTTGCTGGTGACGTAATTGCTCGAGCAATTACGTCACCAGCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033309.2-1769s21c1
Sequence:CCGGAGGTCCCAGAGCAGTGGATATCTCGAGATATCCACTGCTCTGGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033309
B3GNT9 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033309.1-596s1c1
Sequence:CCGGGTTTCCACTGCTCATTAACCACTCGAGTGGTTAATGAGCAGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033309.1-927s1c1
Sequence:CCGGCTCAAGGAGATCCACTTTCTACTCGAGTAGAAAGTGGATCTCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033309.1-2530s1c1
Sequence:CCGGCCCTGCACATTCATCATTAAACTCGAGTTTAATGATGAATGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033309.1-2475s1c1
Sequence:CCGGGCCACACAAACCTGGCTATAACTCGAGTTATAGCCAGGTTTGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-1016s21c1
Sequence:CCGGTGTTCGTGAACGTGGGAAATCCTCGAGGATTTCCCACGTTCACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-669s21c1
Sequence:CCGGGGACCTGCTTATTGCTGTCAACTCGAGTTGACAGCAATAAGCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-1076s21c1
Sequence:CCGGTGCTTGCTGGTGACGTAATTGCTCGAGCAATTACGTCACCAGCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033309.2-1769s21c1
Sequence:CCGGAGGTCCCAGAGCAGTGGATATCTCGAGATATCCACTGCTCTGGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033309
B3GNT9 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033309.1-596s1c1
Sequence:CCGGGTTTCCACTGCTCATTAACCACTCGAGTGGTTAATGAGCAGTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033309.1-927s1c1
Sequence:CCGGCTCAAGGAGATCCACTTTCTACTCGAGTAGAAAGTGGATCTCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033309.1-2530s1c1
Sequence:CCGGCCCTGCACATTCATCATTAAACTCGAGTTTAATGATGAATGTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033309.1-2475s1c1
Sequence:CCGGGCCACACAAACCTGGCTATAACTCGAGTTATAGCCAGGTTTGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-1016s21c1
Sequence:CCGGTGTTCGTGAACGTGGGAAATCCTCGAGGATTTCCCACGTTCACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-669s21c1
Sequence:CCGGGGACCTGCTTATTGCTGTCAACTCGAGTTGACAGCAATAAGCAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033309.2-1076s21c1
Sequence:CCGGTGCTTGCTGGTGACGTAATTGCTCGAGCAATTACGTCACCAGCAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033309.2-1769s21c1
Sequence:CCGGAGGTCCCAGAGCAGTGGATATCTCGAGATATCCACTGCTCTGGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks