EMAIL THIS PAGE TO A FRIEND

B3GNTL1

UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1

50 Gene Product Result for
Synonyms: B3GNT8
UniProtKB ID: Q67FW5, Q6GV30, Q8WUT3
Gene ID:
Mouse(210004) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Rat(367384) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Zebrafish(619261) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
cow(617397) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
domestic cat(101084330) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
dog(608396) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
chicken(417333) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
naked mole-rat(101710150) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
domestic guinea pig(100718650) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
sheep(101103996) UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009905 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009905 Rosetta Predictions human pricing
NM_001015035 Rosetta Predictions rat pricing
NM_178664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119765 predicted 468
2 SASI_Hs01_00119766 predicted 449
3 SASI_Hs01_00119767 predicted 270
4 SASI_Hs01_00119768 predicted 986
5 SASI_Hs01_00119770 predicted 262
6 SASI_Hs01_00119771 predicted 409
7 SASI_Hs01_00119772 predicted 383
8 SASI_Hs01_00119773 predicted 232
9 SASI_Hs01_00119774 predicted 458
10 SASI_Hs02_00305709 predicted 462
11 SASI_Hs01_00119769 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202180 predicted 575
2 SASI_Rn02_00202181 predicted 459
3 SASI_Rn02_00202182 predicted 1132
4 SASI_Rn02_00202183 predicted 1033
5 SASI_Rn02_00202184 predicted 802
6 SASI_Rn02_00202185 predicted 270
7 SASI_Rn02_00202186 predicted 409
8 SASI_Rn02_00202187 predicted 413
9 SASI_Rn02_00202188 predicted 541
10 SASI_Rn02_00202189 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059573 predicted 535
2 SASI_Mm01_00059574 predicted 1194
3 SASI_Mm01_00059575 predicted 497
4 SASI_Mm01_00059576 predicted 1285
5 SASI_Mm01_00059577 predicted 1418
6 SASI_Mm01_00059579 predicted 1225
7 SASI_Mm01_00059580 predicted 576
8 SASI_Mm01_00059581 predicted 802
9 SASI_Mm01_00059582 predicted 267
10 SASI_Mm02_00349121 predicted 1274
11 SASI_Mm01_00059578 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178664
B3GNTL1 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-490s21c1
Sequence:CCGGAGCACCCGACGAGTATCATAGCTCGAGCTATGATACTCGTCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-362s21c1
Sequence:CCGGTCCCAGAGGAGTTGGATATTCCTCGAGGAATATCCAACTCCTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-778s21c1
Sequence:CCGGTCTACCGATACCACCTGTATGCTCGAGCATACAGGTGGTATCGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-535s21c1
Sequence:CCGGCGGACTCTACAGAGCGATATACTCGAGTATATCGCTCTGTAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178664.4-1420s21c1
Sequence:CCGGGCTTTCAAGTCTGGCTATTACCTCGAGGTAATAGCCAGACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178664.2-1517s1c1
Sequence:CCGGGCCCATCTGCAACAGCTTAATCTCGAGATTAAGCTGTTGCAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178664.2-1912s1c1
Sequence:CCGGCGTCTGTGACAGCAAACGTATCTCGAGATACGTTTGCTGTCACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178664.2-1010s1c1
Sequence:CCGGGCTACGAAGACTCACAGGAAACTCGAGTTTCCTGTGAGTCTTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178664
B3GNTL1 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-490s21c1
Sequence:CCGGAGCACCCGACGAGTATCATAGCTCGAGCTATGATACTCGTCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-362s21c1
Sequence:CCGGTCCCAGAGGAGTTGGATATTCCTCGAGGAATATCCAACTCCTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-778s21c1
Sequence:CCGGTCTACCGATACCACCTGTATGCTCGAGCATACAGGTGGTATCGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-535s21c1
Sequence:CCGGCGGACTCTACAGAGCGATATACTCGAGTATATCGCTCTGTAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178664.4-1420s21c1
Sequence:CCGGGCTTTCAAGTCTGGCTATTACCTCGAGGTAATAGCCAGACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178664.2-1517s1c1
Sequence:CCGGGCCCATCTGCAACAGCTTAATCTCGAGATTAAGCTGTTGCAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178664.2-1912s1c1
Sequence:CCGGCGTCTGTGACAGCAAACGTATCTCGAGATACGTTTGCTGTCACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178664.2-1010s1c1
Sequence:CCGGGCTACGAAGACTCACAGGAAACTCGAGTTTCCTGTGAGTCTTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178664
B3GNTL1 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-490s21c1
Sequence:CCGGAGCACCCGACGAGTATCATAGCTCGAGCTATGATACTCGTCGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-362s21c1
Sequence:CCGGTCCCAGAGGAGTTGGATATTCCTCGAGGAATATCCAACTCCTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-778s21c1
Sequence:CCGGTCTACCGATACCACCTGTATGCTCGAGCATACAGGTGGTATCGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178664.4-535s21c1
Sequence:CCGGCGGACTCTACAGAGCGATATACTCGAGTATATCGCTCTGTAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178664.4-1420s21c1
Sequence:CCGGGCTTTCAAGTCTGGCTATTACCTCGAGGTAATAGCCAGACTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202454    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178664.2-1517s1c1
Sequence:CCGGGCCCATCTGCAACAGCTTAATCTCGAGATTAAGCTGTTGCAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178664.2-1912s1c1
Sequence:CCGGCGTCTGTGACAGCAAACGTATCTCGAGATACGTTTGCTGTCACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178664.2-1010s1c1
Sequence:CCGGGCTACGAAGACTCACAGGAAACTCGAGTTTCCTGTGAGTCTTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009905
B3GNTL1 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009905.1-69s1c1
Sequence:CCGGCACGTGTCTATTATCCTCCCACTCGAGTGGGAGGATAATAGACACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009905.1-464s1c1
Sequence:CCGGCGAACGATACACACGTTGGATCTCGAGATCCAACGTGTGTATCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-897s1c1
Sequence:CCGGGACGAGAACAAGATCAGGAAACTCGAGTTTCCTGATCTTGTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-902s1c1
Sequence:CCGGGAACAAGATCAGGAAAGGCTTCTCGAGAAGCCTTTCCTGATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-176s1c1
Sequence:CCGGCAATGATGCCAGTAAGGACAACTCGAGTTGTCCTTACTGGCATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-114s1c1
Sequence:CCGGGACGAATGTTTGAGGTCTGTTCTCGAGAACAGACCTCAAACATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009905
B3GNTL1 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009905.1-69s1c1
Sequence:CCGGCACGTGTCTATTATCCTCCCACTCGAGTGGGAGGATAATAGACACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009905.1-464s1c1
Sequence:CCGGCGAACGATACACACGTTGGATCTCGAGATCCAACGTGTGTATCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-897s1c1
Sequence:CCGGGACGAGAACAAGATCAGGAAACTCGAGTTTCCTGATCTTGTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-902s1c1
Sequence:CCGGGAACAAGATCAGGAAAGGCTTCTCGAGAAGCCTTTCCTGATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-176s1c1
Sequence:CCGGCAATGATGCCAGTAAGGACAACTCGAGTTGTCCTTACTGGCATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-114s1c1
Sequence:CCGGGACGAATGTTTGAGGTCTGTTCTCGAGAACAGACCTCAAACATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009905
B3GNTL1 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009905.1-69s1c1
Sequence:CCGGCACGTGTCTATTATCCTCCCACTCGAGTGGGAGGATAATAGACACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009905.1-464s1c1
Sequence:CCGGCGAACGATACACACGTTGGATCTCGAGATCCAACGTGTGTATCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-897s1c1
Sequence:CCGGGACGAGAACAAGATCAGGAAACTCGAGTTTCCTGATCTTGTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-902s1c1
Sequence:CCGGGAACAAGATCAGGAAAGGCTTCTCGAGAAGCCTTTCCTGATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-176s1c1
Sequence:CCGGCAATGATGCCAGTAAGGACAACTCGAGTTGTCCTTACTGGCATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009905.1-114s1c1
Sequence:CCGGGACGAATGTTTGAGGTCTGTTCTCGAGAACAGACCTCAAACATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194288
B3GNTL1 MISSION shRNA Bacterial Glycerol Stock
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1291s1c1
Sequence:CCGGCGTGAACACATCCCTAAACCACTCGAGTGGTTTAGGGATGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1709s1c1
Sequence:CCGGGAGTGTGTTCTCATGGTGGTTCTCGAGAACCACCATGAGAACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-1877s1c1
Sequence:CCGGGCTCGACTTTGTTGGTTTAATCTCGAGATTAAACCAACAAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-2101s1c1
Sequence:CCGGGCAGAGTGTGTGGAAATGTTTCTCGAGAAACATTTCCACACACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-2135s1c1
Sequence:CCGGGCTTTGAGTGACAGCATCATTCTCGAGAATGATGCTGTCACTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1292s1c1
Sequence:CCGGGTGAACACATCCCTAAACCATCTCGAGATGGTTTAGGGATGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1347s1c1
Sequence:CCGGGCAGAATCCAGTGTCTGTGTTCTCGAGAACACAGACACTGGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194288
B3GNTL1 MISSION shRNA shRNA Plasmid DNA
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1291s1c1
Sequence:CCGGCGTGAACACATCCCTAAACCACTCGAGTGGTTTAGGGATGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1709s1c1
Sequence:CCGGGAGTGTGTTCTCATGGTGGTTCTCGAGAACCACCATGAGAACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-1877s1c1
Sequence:CCGGGCTCGACTTTGTTGGTTTAATCTCGAGATTAAACCAACAAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-2101s1c1
Sequence:CCGGGCAGAGTGTGTGGAAATGTTTCTCGAGAAACATTTCCACACACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-2135s1c1
Sequence:CCGGGCTTTGAGTGACAGCATCATTCTCGAGAATGATGCTGTCACTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1292s1c1
Sequence:CCGGGTGAACACATCCCTAAACCATCTCGAGATGGTTTAGGGATGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1347s1c1
Sequence:CCGGGCAGAATCCAGTGTCTGTGTTCTCGAGAACACAGACACTGGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194288
B3GNTL1 MISSION shRNA Lentiviral Transduction Particles
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1291s1c1
Sequence:CCGGCGTGAACACATCCCTAAACCACTCGAGTGGTTTAGGGATGTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1709s1c1
Sequence:CCGGGAGTGTGTTCTCATGGTGGTTCTCGAGAACCACCATGAGAACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161715    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-1877s1c1
Sequence:CCGGGCTCGACTTTGTTGGTTTAATCTCGAGATTAAACCAACAAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-2101s1c1
Sequence:CCGGGCAGAGTGTGTGGAAATGTTTCTCGAGAAACATTTCCACACACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194288.1-2135s1c1
Sequence:CCGGGCTTTGAGTGACAGCATCATTCTCGAGAATGATGCTGTCACTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1292s1c1
Sequence:CCGGGTGAACACATCCCTAAACCATCTCGAGATGGTTTAGGGATGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194288.1-1347s1c1
Sequence:CCGGGCAGAATCCAGTGTCTGTGTTCTCGAGAACACAGACACTGGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks