EMAIL THIS PAGE TO A FRIEND

B4GALNT1

beta-1,4-N-acetyl-galactosaminyl transferase 1

81 Gene Product Result for
Synonyms: GALGT GALNACT GalNAc-T SPG26
UniProtKB ID: Q00973
Gene ID:
Human(2583) Summary: GM2 and GD2 gangliosides are sialic acid-containing glycosphingolipids. GalNAc-T is the enzyme involved in the biosynthesis of G(M2) and G(D2) glycosphingolipids. GalNAc-T catalyzes the transfer of GalNAc into G(M3) and G(D3) by a beta-1,4 linkage, resulting in the synthesis of G(M2) and G(D2), respectively. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(14421) beta-1,4-N-acetyl-galactosaminyl transferase 1
Rat(64828) beta-1,4-N-acetyl-galactosaminyl transferase 1
naked mole-rat(101705101) beta-1,4-N-acetyl-galactosaminyl transferase 1
domestic guinea pig(100719351) beta-1,4-N-acetyl-galactosaminyl transferase 1
sheep(101119388) beta-1,4-N-acetyl-galactosaminyl transferase 1
Domestic Rabbit(100340284) beta-1,4-N-acetyl-galactosaminyl transferase 1
cow(520159) beta-1,4-N-acetyl-galactosaminyl transferase 1
domestic cat(101082581) beta-1,4-N-acetyl-galactosaminyl transferase 1
dog(481129) beta-1,4-N-acetyl-galactosaminyl transferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001478 Rosetta Predictions human pricing
NM_022860 Rosetta Predictions rat pricing
NM_008080 Rosetta Predictions mouse pricing
NM_027739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166038 predicted 1207
2 SASI_Hs01_00166039 predicted 1325
3 SASI_Hs01_00166041 predicted 1352
4 SASI_Hs01_00166042 predicted 1278
5 SASI_Hs01_00166044 predicted 1442
6 SASI_Hs01_00166045 predicted 1260
7 SASI_Hs01_00166046 predicted 1008
8 SASI_Hs02_00331951 predicted 1972
9 SASI_Hs02_00331952 predicted 1135
10 SASI_Hs02_00331953 predicted 1093
11 SASI_Hs01_00166040 predicted 2140
12 SASI_Hs01_00166043 predicted 1461
13 SASI_Hs01_00166047 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063235 predicted 763
2 SASI_Rn01_00063236 predicted 1497
3 SASI_Rn01_00063237 predicted 878
4 SASI_Rn01_00063238 predicted 841
5 SASI_Rn01_00063239 predicted 987
6 SASI_Rn01_00063240 predicted 302
7 SASI_Rn01_00063242 predicted 1486
8 SASI_Rn01_00063243 predicted 499
9 SASI_Rn01_00063244 predicted 1318
10 SASI_Rn02_00263591 predicted 391
11 SASI_Rn01_00063241 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104821 predicted 1457
2 SASI_Mm01_00104822 predicted 1715
3 SASI_Mm02_00313090 predicted 1718
4 SASI_Mm01_00104824 predicted 1233
5 SASI_Mm01_00104825 predicted 802
6 SASI_Mm01_00104826 predicted 1931
7 SASI_Mm01_00104827 predicted 1130
8 SASI_Mm01_00104828 predicted 1333
9 SASI_Mm01_00104829 predicted 1669
10 SASI_Mm01_00104830 predicted 791
11 SASI_Mm01_00104823 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332669 predicted 1329
2 SASI_Mm02_00332670 predicted 1599
3 SASI_Mm02_00332671 predicted 1598
4 SASI_Mm02_00332672 predicted 1105
5 SASI_Mm02_00332673 predicted 677
6 SASI_Mm02_00332674 predicted 1812
7 SASI_Mm02_00332675 predicted 1008
8 SASI_Mm02_00332676 predicted 1216
9 SASI_Mm02_00332677 predicted 1550
10 SASI_Mm02_00332678 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008080
VALIDATED
B4GALNT1 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008080.3-1940s1c1
Sequence:CCGGCCTTGTTCCTTCCAGGATTATCTCGAGATAATCCTGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008080.3-1328s1c1
Sequence:CCGGGTCCCAAGTAACCACCAAATACTCGAGTATTTGGTGGTTACTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-362s1c1
Sequence:CCGGCCTGTACTCCAGCACCCGAAACTCGAGTTTCGGGTGCTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-926s1c1
Sequence:CCGGCCCAGTTCTGGATAAACTCAACTCGAGTTGAGTTTATCCAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-1109s1c1
Sequence:CCGGCGAGTACAACATCAGTGCTCTCTCGAGAGAGCACTGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008080.4-1940s21c1
Sequence:CCGGCCTTGTTCCTTCCAGGATTATCTCGAGATAATCCTGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-926s21c2
Sequence:CCGGCCCAGTTCTGGATAAACTCAACTCGAGTTGAGTTTATCCAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-1109s21c3
Sequence:CCGGCGAGTACAACATCAGTGCTCTCTCGAGAGAGCACTGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-362s21c2
Sequence:CCGGCCTGTACTCCAGCACCCGAAACTCGAGTTTCGGGTGCTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008080
VALIDATED
B4GALNT1 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008080.3-1940s1c1
Sequence:CCGGCCTTGTTCCTTCCAGGATTATCTCGAGATAATCCTGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008080.3-1328s1c1
Sequence:CCGGGTCCCAAGTAACCACCAAATACTCGAGTATTTGGTGGTTACTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-362s1c1
Sequence:CCGGCCTGTACTCCAGCACCCGAAACTCGAGTTTCGGGTGCTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-926s1c1
Sequence:CCGGCCCAGTTCTGGATAAACTCAACTCGAGTTGAGTTTATCCAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-1109s1c1
Sequence:CCGGCGAGTACAACATCAGTGCTCTCTCGAGAGAGCACTGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008080.4-1940s21c1
Sequence:CCGGCCTTGTTCCTTCCAGGATTATCTCGAGATAATCCTGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-926s21c2
Sequence:CCGGCCCAGTTCTGGATAAACTCAACTCGAGTTGAGTTTATCCAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-1109s21c3
Sequence:CCGGCGAGTACAACATCAGTGCTCTCTCGAGAGAGCACTGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-362s21c2
Sequence:CCGGCCTGTACTCCAGCACCCGAAACTCGAGTTTCGGGTGCTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008080
VALIDATED
B4GALNT1 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008080.3-1940s1c1
Sequence:CCGGCCTTGTTCCTTCCAGGATTATCTCGAGATAATCCTGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008080.3-1328s1c1
Sequence:CCGGGTCCCAAGTAACCACCAAATACTCGAGTATTTGGTGGTTACTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-362s1c1
Sequence:CCGGCCTGTACTCCAGCACCCGAAACTCGAGTTTCGGGTGCTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-926s1c1
Sequence:CCGGCCCAGTTCTGGATAAACTCAACTCGAGTTGAGTTTATCCAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008080.3-1109s1c1
Sequence:CCGGCGAGTACAACATCAGTGCTCTCTCGAGAGAGCACTGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008080.4-1940s21c1
Sequence:CCGGCCTTGTTCCTTCCAGGATTATCTCGAGATAATCCTGGAAGGAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-926s21c2
Sequence:CCGGCCCAGTTCTGGATAAACTCAACTCGAGTTGAGTTTATCCAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-1109s21c3
Sequence:CCGGCGAGTACAACATCAGTGCTCTCTCGAGAGAGCACTGATGTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008080.4-362s21c2
Sequence:CCGGCCTGTACTCCAGCACCCGAAACTCGAGTTTCGGGTGCTGGAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001478
VALIDATED
B4GALNT1 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001478.2-2084s1c1
Sequence:CCGGCCTGCCAGGAATTTCCAACAACTCGAGTTGTTGGAAATTCCTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001478.2-1172s1c1
Sequence:CCGGGCTGCTTTCACTATCCGCATACTCGAGTATGCGGATAGTGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001478.2-1462s1c1
Sequence:CCGGCGTGTCTCAAGTAACCACCAACTCGAGTTGGTGGTTACTTGAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001478.2-712s1c1
Sequence:CCGGCCAGAAACAAGTCCGAGCTATCTCGAGATAGCTCGGACTTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1256s21c1
Sequence:CCGGTCAGCGCTCTAGTCACGATTGCTCGAGCAATCGTGACTAGAGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1865s21c1
Sequence:CCGGACGTCGTGGTGGATCATGCATCTCGAGATGCATGATCCACCACGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1308s21c1
Sequence:CCGGACGGGCTCTCATCACCAGTATCTCGAGATACTGGTGATGAGAGCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001478.3-2532s21c1
Sequence:CCGGGTTGGTGAAAGCCATTCTTAGCTCGAGCTAAGAATGGCTTTCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1115s21c1
Sequence:CCGGGAAGCTACCAGACCAACACAGCTCGAGCTGTGTTGGTCTGGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1087s21c1
Sequence:CCGGCAACTACAACTGGTCACTTACCTCGAGGTAAGTGACCAGTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1006s21c1
Sequence:CCGGGAAGTGACTGGAGTTACTCTCCTCGAGGAGAGTAACTCCAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001478
VALIDATED
B4GALNT1 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001478.2-2084s1c1
Sequence:CCGGCCTGCCAGGAATTTCCAACAACTCGAGTTGTTGGAAATTCCTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001478.2-1172s1c1
Sequence:CCGGGCTGCTTTCACTATCCGCATACTCGAGTATGCGGATAGTGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001478.2-1462s1c1
Sequence:CCGGCGTGTCTCAAGTAACCACCAACTCGAGTTGGTGGTTACTTGAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001478.2-712s1c1
Sequence:CCGGCCAGAAACAAGTCCGAGCTATCTCGAGATAGCTCGGACTTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1256s21c1
Sequence:CCGGTCAGCGCTCTAGTCACGATTGCTCGAGCAATCGTGACTAGAGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1865s21c1
Sequence:CCGGACGTCGTGGTGGATCATGCATCTCGAGATGCATGATCCACCACGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1308s21c1
Sequence:CCGGACGGGCTCTCATCACCAGTATCTCGAGATACTGGTGATGAGAGCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001478.3-2532s21c1
Sequence:CCGGGTTGGTGAAAGCCATTCTTAGCTCGAGCTAAGAATGGCTTTCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1115s21c1
Sequence:CCGGGAAGCTACCAGACCAACACAGCTCGAGCTGTGTTGGTCTGGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1087s21c1
Sequence:CCGGCAACTACAACTGGTCACTTACCTCGAGGTAAGTGACCAGTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1006s21c1
Sequence:CCGGGAAGTGACTGGAGTTACTCTCCTCGAGGAGAGTAACTCCAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001478
VALIDATED
B4GALNT1 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_001478.2-2084s1c1
Sequence:CCGGCCTGCCAGGAATTTCCAACAACTCGAGTTGTTGGAAATTCCTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001478.2-1172s1c1
Sequence:CCGGGCTGCTTTCACTATCCGCATACTCGAGTATGCGGATAGTGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001478.2-1462s1c1
Sequence:CCGGCGTGTCTCAAGTAACCACCAACTCGAGTTGGTGGTTACTTGAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001478.2-712s1c1
Sequence:CCGGCCAGAAACAAGTCCGAGCTATCTCGAGATAGCTCGGACTTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1256s21c1
Sequence:CCGGTCAGCGCTCTAGTCACGATTGCTCGAGCAATCGTGACTAGAGCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1865s21c1
Sequence:CCGGACGTCGTGGTGGATCATGCATCTCGAGATGCATGATCCACCACGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1308s21c1
Sequence:CCGGACGGGCTCTCATCACCAGTATCTCGAGATACTGGTGATGAGAGCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001478.3-2532s21c1
Sequence:CCGGGTTGGTGAAAGCCATTCTTAGCTCGAGCTAAGAATGGCTTTCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1115s21c1
Sequence:CCGGGAAGCTACCAGACCAACACAGCTCGAGCTGTGTTGGTCTGGTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1087s21c1
Sequence:CCGGCAACTACAACTGGTCACTTACCTCGAGGTAAGTGACCAGTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001478.3-1006s21c1
Sequence:CCGGGAAGTGACTGGAGTTACTCTCCTCGAGGAGAGTAACTCCAGTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks