EMAIL THIS PAGE TO A FRIEND

B4GALNT2

beta-1,4-N-acetyl-galactosaminyl transferase 2

33 Gene Product Result for
Synonyms: B4GALT GALGT2
UniProtKB ID: Q8NHY0, B4DZE4, Q14CP1, Q86Y40
Gene ID:
Human(124872) Summary: B4GALNT2 catalyzes the last step in the biosynthesis of the human Sd(a) antigen through the addition of an N-acetylgalactosamine residue via a beta-1,4 linkage to a subterminal galactose residue substituted with an alpha-2,3-linked sialic acid. B4GALNT2 also catalyzes the last step in the biosynthesis of the Cad antigen (Montiel et al., 2003 [PubMed 12678917]
Mouse(14422) beta-1,4-N-acetyl-galactosaminyl transferase 2
Zebrafish(558078) beta-1,4-N-acetyl-galactosaminyl transferase 2
dog(491067) beta-1,4-N-acetyl-galactosaminyl transferase 2
cow(508108) beta-1,4-N-acetyl-galactosaminyl transferase 2
domestic cat(101080338) beta-1,4-N-acetyl-galactosaminyl transferase 2
sheep(101119323) beta-1,4-N-acetyl-galactosaminyl transferase 2
Domestic Rabbit(100349858) beta-1,4-N-acetyl-galactosaminyl transferase 2
domestic guinea pig(100717731) beta-1,4-N-acetyl-galactosaminyl transferase 2
naked mole-rat(101720363) beta-1,4-N-acetyl-galactosaminyl transferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049391 MISSION® esiRNA esiRNA human B4GALNT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153446 Rosetta Predictions human pricing
NM_008081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120132 predicted 1103
2 SASI_Hs01_00120133 predicted 319
3 SASI_Hs01_00120135 predicted 970
4 SASI_Hs02_00367286 predicted 756
5 SASI_Hs01_00120136 predicted 287
6 SASI_Hs01_00120137 predicted 1011
7 SASI_Hs01_00120138 predicted 445
8 SASI_Hs01_00120139 predicted 1013
9 SASI_Hs01_00120140 predicted 269
10 SASI_Hs01_00120141 predicted 719
11 SASI_Hs01_00120134 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142247 predicted 540
2 SASI_Mm01_00142248 predicted 752
3 SASI_Mm01_00142249 predicted 303
4 SASI_Mm01_00142250 predicted 721
5 SASI_Mm02_00313091 predicted 906
6 SASI_Mm01_00142251 predicted 781
7 SASI_Mm01_00142252 predicted 1194
8 SASI_Mm01_00142254 predicted 372
9 SASI_Mm01_00142255 predicted 664
10 SASI_Mm01_00142256 predicted 766
11 SASI_Mm01_00142253 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153446
B4GALNT2 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-1350s1c1
Sequence:CCGGCTGGGAAATGTGTTCCAGTTTCTCGAGAAACTGGAACACATTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-272s1c1
Sequence:CCGGCCTCAAGATATTGGTCATAATCTCGAGATTATGACCAATATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-843s1c1
Sequence:CCGGCGGAAGCTGTTGAAGTTCATTCTCGAGAATGAACTTCAACAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-1079s1c1
Sequence:CCGGCCGGAGTATTCGAGAGTATTACTCGAGTAATACTCTCGAATACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-564s1c1
Sequence:CCGGCAGGCTGAATTTGAACACTTTCTCGAGAAAGTGTTCAAATTCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153446
B4GALNT2 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-1350s1c1
Sequence:CCGGCTGGGAAATGTGTTCCAGTTTCTCGAGAAACTGGAACACATTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-272s1c1
Sequence:CCGGCCTCAAGATATTGGTCATAATCTCGAGATTATGACCAATATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-843s1c1
Sequence:CCGGCGGAAGCTGTTGAAGTTCATTCTCGAGAATGAACTTCAACAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-1079s1c1
Sequence:CCGGCCGGAGTATTCGAGAGTATTACTCGAGTAATACTCTCGAATACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-564s1c1
Sequence:CCGGCAGGCTGAATTTGAACACTTTCTCGAGAAAGTGTTCAAATTCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153446
B4GALNT2 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-1350s1c1
Sequence:CCGGCTGGGAAATGTGTTCCAGTTTCTCGAGAAACTGGAACACATTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-272s1c1
Sequence:CCGGCCTCAAGATATTGGTCATAATCTCGAGATTATGACCAATATCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-843s1c1
Sequence:CCGGCGGAAGCTGTTGAAGTTCATTCTCGAGAATGAACTTCAACAGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-1079s1c1
Sequence:CCGGCCGGAGTATTCGAGAGTATTACTCGAGTAATACTCTCGAATACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153446.1-564s1c1
Sequence:CCGGCAGGCTGAATTTGAACACTTTCTCGAGAAAGTGTTCAAATTCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008081
B4GALNT2 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-1467s1c1
Sequence:CCGGGCTGCCTTGGAGAAGACTTATCTCGAGATAAGTCTTCTCCAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-122s1c1
Sequence:CCGGTGTTGCGTTTATGGTGAGAAACTCGAGTTTCTCACCATAAACGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-86s1c1
Sequence:CCGGCCTCAAGACATTTGTCCTCATCTCGAGATGAGGACAAATGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-956s1c1
Sequence:CCGGCCTGGAAATTAATGATGACTACTCGAGTAGTCATCATTAATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-1359s1c1
Sequence:CCGGGCCCACGGAGAGTTCTTTATTCTCGAGAATAAAGAACTCTCCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008081
B4GALNT2 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-1467s1c1
Sequence:CCGGGCTGCCTTGGAGAAGACTTATCTCGAGATAAGTCTTCTCCAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-122s1c1
Sequence:CCGGTGTTGCGTTTATGGTGAGAAACTCGAGTTTCTCACCATAAACGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-86s1c1
Sequence:CCGGCCTCAAGACATTTGTCCTCATCTCGAGATGAGGACAAATGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-956s1c1
Sequence:CCGGCCTGGAAATTAATGATGACTACTCGAGTAGTCATCATTAATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-1359s1c1
Sequence:CCGGGCCCACGGAGAGTTCTTTATTCTCGAGAATAAAGAACTCTCCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008081
B4GALNT2 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-1467s1c1
Sequence:CCGGGCTGCCTTGGAGAAGACTTATCTCGAGATAAGTCTTCTCCAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-122s1c1
Sequence:CCGGTGTTGCGTTTATGGTGAGAAACTCGAGTTTCTCACCATAAACGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-86s1c1
Sequence:CCGGCCTCAAGACATTTGTCCTCATCTCGAGATGAGGACAAATGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-956s1c1
Sequence:CCGGCCTGGAAATTAATGATGACTACTCGAGTAGTCATCATTAATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008081.1-1359s1c1
Sequence:CCGGGCCCACGGAGAGTTCTTTATTCTCGAGAATAAAGAACTCTCCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks