EMAIL THIS PAGE TO A FRIEND

B4GALNT3

beta-1,4-N-acetyl-galactosaminyl transferase 3

UniProtKB ID: Q6L9W6, Q6ZNC1, Q8N7T6
Gene ID:
Human(283358) Summary: B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]
Mouse(330406) beta-1,4-N-acetyl-galactosaminyl transferase 3
Rat(500306) beta-1,4-N-acetyl-galactosaminyl transferase 3
naked mole-rat(101702463) beta-1,4-N-acetyl-galactosaminyl transferase 3
domestic guinea pig(100730678) beta-1,4-N-acetyl-galactosaminyl transferase 3
sheep(101115274) beta-1,4-N-acetyl-galactosaminyl transferase 3
Domestic Rabbit(100351156) beta-1,4-N-acetyl-galactosaminyl transferase 3
chicken(418150) beta-1,4-N-acetyl-galactosaminyl transferase 3
cow(527026) beta-1,4-N-acetyl-galactosaminyl transferase 3
Horse(100056854) beta-1,4-N-acetyl-galactosaminyl transferase 3
dog(486751) beta-1,4-N-acetyl-galactosaminyl transferase 3
domestic cat(101097324) beta-1,4-N-acetyl-galactosaminyl transferase 3
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173593 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060541 MISSION® esiRNA esiRNA human B4GALNT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173593 Rosetta Predictions human pricing
XM_575655 Rosetta Predictions rat pricing
NM_198884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082798 predicted 2538
2 SASI_Hs02_00368434 predicted 669
3 SASI_Hs01_00082799 predicted 290
4 SASI_Hs01_00082800 predicted 1280
5 SASI_Hs01_00082801 predicted 486
6 SASI_Hs01_00082802 predicted 1057
7 SASI_Hs01_00082803 predicted 2464
8 SASI_Hs01_00082804 predicted 2463
9 SASI_Hs01_00082805 predicted 2448
10 SASI_Hs01_00082807 predicted 776
11 SASI_Hs01_00082806 predicted 2824
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403998 predicted 1109
2 SASI_Rn02_00403999 predicted 677
3 SASI_Rn02_00404000 predicted 2257
4 SASI_Rn02_00404001 predicted 1283
5 SASI_Rn02_00404002 predicted 1393
6 SASI_Rn02_00404003 predicted 2560
7 SASI_Rn02_00404004 predicted 673
8 SASI_Rn02_00404005 predicted 804
9 SASI_Rn02_00404006 predicted 2435
10 SASI_Rn02_00404007 predicted 2510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192991 predicted 2080
2 SASI_Mm01_00192992 predicted 2605
3 SASI_Mm01_00192993 predicted 680
4 SASI_Mm01_00192994 predicted 218
5 SASI_Mm01_00192995 predicted 299
6 SASI_Mm02_00351206 predicted 2409
7 SASI_Mm01_00192996 predicted 1402
8 SASI_Mm01_00192997 predicted 2602
9 SASI_Mm01_00192998 predicted 360
10 SASI_Mm02_00351207 predicted 2242
11 SASI_Mm01_00192999 predicted 1337
12 SASI_Mm01_00193000 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198884
B4GALNT3 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198884.1-232s1c1
Sequence:CCGGCCGAATCTCCAATTCTACCGTCTCGAGACGGTAGAATTGGAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198884.1-660s1c1
Sequence:CCGGCCCTGGAGAGTTTGGGAAATTCTCGAGAATTTCCCAAACTCTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-1932s1c1
Sequence:CCGGGAACTGTAACACATCGGGCAACTCGAGTTGCCCGATGTGTTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-2413s1c1
Sequence:CCGGGATGCACATTTCAGCATCATTCTCGAGAATGATGCTGAAATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-856s1c1
Sequence:CCGGGAGACCATCCTAAGGATGGATCTCGAGATCCATCCTTAGGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-1331s1c1
Sequence:CCGGCCACCTCTCAAGACCAGAATACTCGAGTATTCTGGTCTTGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198884
B4GALNT3 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198884.1-232s1c1
Sequence:CCGGCCGAATCTCCAATTCTACCGTCTCGAGACGGTAGAATTGGAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198884.1-660s1c1
Sequence:CCGGCCCTGGAGAGTTTGGGAAATTCTCGAGAATTTCCCAAACTCTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-1932s1c1
Sequence:CCGGGAACTGTAACACATCGGGCAACTCGAGTTGCCCGATGTGTTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-2413s1c1
Sequence:CCGGGATGCACATTTCAGCATCATTCTCGAGAATGATGCTGAAATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-856s1c1
Sequence:CCGGGAGACCATCCTAAGGATGGATCTCGAGATCCATCCTTAGGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-1331s1c1
Sequence:CCGGCCACCTCTCAAGACCAGAATACTCGAGTATTCTGGTCTTGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198884
B4GALNT3 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198884.1-232s1c1
Sequence:CCGGCCGAATCTCCAATTCTACCGTCTCGAGACGGTAGAATTGGAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198884.1-660s1c1
Sequence:CCGGCCCTGGAGAGTTTGGGAAATTCTCGAGAATTTCCCAAACTCTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-1932s1c1
Sequence:CCGGGAACTGTAACACATCGGGCAACTCGAGTTGCCCGATGTGTTACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-2413s1c1
Sequence:CCGGGATGCACATTTCAGCATCATTCTCGAGAATGATGCTGAAATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-856s1c1
Sequence:CCGGGAGACCATCCTAAGGATGGATCTCGAGATCCATCCTTAGGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198884.1-1331s1c1
Sequence:CCGGCCACCTCTCAAGACCAGAATACTCGAGTATTCTGGTCTTGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173593
B4GALNT3 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-2544s1c1
Sequence:CCGGCGTGAAGCTAAGTGGAAACTTCTCGAGAAGTTTCCACTTAGCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-2451s1c1
Sequence:CCGGCCCACACTTCAACATCGTCATCTCGAGATGACGATGTTGAAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1152s1c1
Sequence:CCGGCCACATGGAGACCCACAATAACTCGAGTTATTGTGGGTCTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1101s1c1
Sequence:CCGGCCGGTTTGTTCATCTGTCTTTCTCGAGAAAGACAGATGAACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1565s1c1
Sequence:CCGGCCAGCCAAGATTCACCTCATTCTCGAGAATGAGGTGAATCTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173593.3-2399s21c1
Sequence:CCGCGGGTACAGCAATTCATCAAAGCTCGAGCTTTGATGAATTGCTGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173593.3-1878s21c1
Sequence:CCGGTGTGTTTGACCCGGTAGTAAACTCGAGTTTACTACCGGGTCAAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173593
B4GALNT3 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-2544s1c1
Sequence:CCGGCGTGAAGCTAAGTGGAAACTTCTCGAGAAGTTTCCACTTAGCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-2451s1c1
Sequence:CCGGCCCACACTTCAACATCGTCATCTCGAGATGACGATGTTGAAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1152s1c1
Sequence:CCGGCCACATGGAGACCCACAATAACTCGAGTTATTGTGGGTCTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1101s1c1
Sequence:CCGGCCGGTTTGTTCATCTGTCTTTCTCGAGAAAGACAGATGAACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1565s1c1
Sequence:CCGGCCAGCCAAGATTCACCTCATTCTCGAGAATGAGGTGAATCTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173593.3-2399s21c1
Sequence:CCGCGGGTACAGCAATTCATCAAAGCTCGAGCTTTGATGAATTGCTGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173593.3-1878s21c1
Sequence:CCGGTGTGTTTGACCCGGTAGTAAACTCGAGTTTACTACCGGGTCAAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173593
B4GALNT3 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-2544s1c1
Sequence:CCGGCGTGAAGCTAAGTGGAAACTTCTCGAGAAGTTTCCACTTAGCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-2451s1c1
Sequence:CCGGCCCACACTTCAACATCGTCATCTCGAGATGACGATGTTGAAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1152s1c1
Sequence:CCGGCCACATGGAGACCCACAATAACTCGAGTTATTGTGGGTCTCCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1101s1c1
Sequence:CCGGCCGGTTTGTTCATCTGTCTTTCTCGAGAAAGACAGATGAACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173593.2-1565s1c1
Sequence:CCGGCCAGCCAAGATTCACCTCATTCTCGAGAATGAGGTGAATCTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173593.3-2399s21c1
Sequence:CCGCGGGTACAGCAATTCATCAAAGCTCGAGCTTTGATGAATTGCTGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173593.3-1878s21c1
Sequence:CCGGTGTGTTTGACCCGGTAGTAAACTCGAGTTTACTACCGGGTCAAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks