EMAIL THIS PAGE TO A FRIEND

B4GALNT4

beta-1,4-N-acetyl-galactosaminyl transferase 4

42 Gene Product Result for
UniProtKB ID: Q76KP1, Q96LV2
Gene ID:
Mouse(330671) beta-1,4-N-acetyl-galactosaminyl transferase 4
Rat(309105) beta-1,4-N-acetyl-galactosaminyl transferase 4
chicken(770601) beta-1,4-N-acetyl-galactosaminyl transferase 4
domestic cat(101086091) beta-1,4-N-acetyl-galactosaminyl transferase 4
cow(100137759) beta-1,4-N-acetyl-galactosaminyl transferase 4
Horse(100054676) beta-1,4-N-acetyl-galactosaminyl transferase 4
dog(483398) beta-1,4-N-acetyl-galactosaminyl transferase 4
sheep(101105615) beta-1,4-N-acetyl-galactosaminyl transferase 4
domestic guinea pig(100712778) beta-1,4-N-acetyl-galactosaminyl transferase 4
naked mole-rat(101720559) beta-1,4-N-acetyl-galactosaminyl transferase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053126 Anti-B4GALNT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025691 MISSION® esiRNA esiRNA targeting mouse B4galnt4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178537 Rosetta Predictions human pricing
NM_001107562 Rosetta Predictions rat pricing
NM_177897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224503 predicted 1088
2 SASI_Hs01_00224504 predicted 348
3 SASI_Hs01_00224505 predicted 2861
4 SASI_Hs01_00224506 predicted 812
5 SASI_Hs01_00224507 predicted 304
6 SASI_Hs01_00224508 predicted 2161
7 SASI_Hs01_00224509 predicted 2690
8 SASI_Hs01_00224510 predicted 481
9 SASI_Hs01_00224511 predicted 2874
10 SASI_Hs02_00369774 predicted 658
11 SASI_Hs01_00224512 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230055 predicted 2320
2 SASI_Rn02_00230056 predicted 3009
3 SASI_Rn02_00230057 predicted 1215
4 SASI_Rn02_00230058 predicted 2184
5 SASI_Rn02_00230059 predicted 513
6 SASI_Rn02_00230060 predicted 472
7 SASI_Rn02_00230061 predicted 1633
8 SASI_Rn02_00230062 predicted 2260
9 SASI_Rn02_00230063 predicted 960
10 SASI_Rn02_00230064 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115407 predicted 346
2 SASI_Mm01_00115408 predicted 1933
3 SASI_Mm01_00115409 predicted 1182
4 SASI_Mm01_00115410 predicted 783
5 SASI_Mm01_00115411 predicted 431
6 SASI_Mm01_00115412 predicted 1188
7 SASI_Mm01_00115413 predicted 2141
8 SASI_Mm01_00115415 predicted 2476
9 SASI_Mm01_00115416 predicted 818
10 SASI_Mm02_00348375 predicted 1089
11 SASI_Mm01_00115414 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178537
B4GALNT4 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-1200s21c1
Sequence:CCGGGGAGAGGTTTGGGTTCTATAACTCGAGTTATAGAACCCAAACCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-368s21c1
Sequence:CCGGAGGTGAACCTGCACGTGTTTGCTCGAGCAAACACGTGCAGGTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-3038s21c1
Sequence:CCGGTCCGACTGCGGAATTTCTATCCTCGAGGATAGAAATTCCGCAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-657s1c1
Sequence:CCGGGCCTGGAGAATTCACCAAGTTCTCGAGAACTTGGTGAATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-1089s1c1
Sequence:CCGGGCAATTTGTGTACCTGTCCTTCTCGAGAAGGACAGGTACACAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-717s1c1
Sequence:CCGGCCGGAGGTACTACTTTGAGTTCTCGAGAACTCAAAGTAGTACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-2652s1c1
Sequence:CCGGCCTGAGACGAACCGGGAACTTCTCGAGAAGTTCCCGGTTCGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-2901s1c1
Sequence:CCGGTGGGATCTACAAGTCGGACTTCTCGAGAAGTCCGACTTGTAGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178537
B4GALNT4 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-1200s21c1
Sequence:CCGGGGAGAGGTTTGGGTTCTATAACTCGAGTTATAGAACCCAAACCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-368s21c1
Sequence:CCGGAGGTGAACCTGCACGTGTTTGCTCGAGCAAACACGTGCAGGTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-3038s21c1
Sequence:CCGGTCCGACTGCGGAATTTCTATCCTCGAGGATAGAAATTCCGCAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-657s1c1
Sequence:CCGGGCCTGGAGAATTCACCAAGTTCTCGAGAACTTGGTGAATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-1089s1c1
Sequence:CCGGGCAATTTGTGTACCTGTCCTTCTCGAGAAGGACAGGTACACAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-717s1c1
Sequence:CCGGCCGGAGGTACTACTTTGAGTTCTCGAGAACTCAAAGTAGTACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-2652s1c1
Sequence:CCGGCCTGAGACGAACCGGGAACTTCTCGAGAAGTTCCCGGTTCGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-2901s1c1
Sequence:CCGGTGGGATCTACAAGTCGGACTTCTCGAGAAGTCCGACTTGTAGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178537
B4GALNT4 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-1200s21c1
Sequence:CCGGGGAGAGGTTTGGGTTCTATAACTCGAGTTATAGAACCCAAACCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-368s21c1
Sequence:CCGGAGGTGAACCTGCACGTGTTTGCTCGAGCAAACACGTGCAGGTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178537.4-3038s21c1
Sequence:CCGGTCCGACTGCGGAATTTCTATCCTCGAGGATAGAAATTCCGCAGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-657s1c1
Sequence:CCGGGCCTGGAGAATTCACCAAGTTCTCGAGAACTTGGTGAATTCTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-1089s1c1
Sequence:CCGGGCAATTTGTGTACCTGTCCTTCTCGAGAAGGACAGGTACACAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-717s1c1
Sequence:CCGGCCGGAGGTACTACTTTGAGTTCTCGAGAACTCAAAGTAGTACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-2652s1c1
Sequence:CCGGCCTGAGACGAACCGGGAACTTCTCGAGAAGTTCCCGGTTCGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178537.3-2901s1c1
Sequence:CCGGTGGGATCTACAAGTCGGACTTCTCGAGAAGTCCGACTTGTAGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177897
B4GALNT4 MISSION shRNA Bacterial Glycerol Stock
beta-1,4-N-acetyl-galactosaminyl transferase 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-2440s1c1
Sequence:CCGGCGTCAGGATGTCATGGTTCATCTCGAGATGAACCATGACATCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-2736s1c1
Sequence:CCGGCATCCACTTCCCACCTAATATCTCGAGATATTAGGTGGGAAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-1182s1c1
Sequence:CCGGCCCACTATACCTGGAAAGGTTCTCGAGAACCTTTCCAGGTATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-736s1c2
Sequence:CCGGGAACTGCTCCACAAGCAAGATCTCGAGATCTTGCTTGTGGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177897
B4GALNT4 MISSION shRNA shRNA Plasmid DNA
beta-1,4-N-acetyl-galactosaminyl transferase 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-2440s1c1
Sequence:CCGGCGTCAGGATGTCATGGTTCATCTCGAGATGAACCATGACATCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-2736s1c1
Sequence:CCGGCATCCACTTCCCACCTAATATCTCGAGATATTAGGTGGGAAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-1182s1c1
Sequence:CCGGCCCACTATACCTGGAAAGGTTCTCGAGAACCTTTCCAGGTATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-736s1c2
Sequence:CCGGGAACTGCTCCACAAGCAAGATCTCGAGATCTTGCTTGTGGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177897
B4GALNT4 MISSION shRNA Lentiviral Transduction Particles
beta-1,4-N-acetyl-galactosaminyl transferase 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-2440s1c1
Sequence:CCGGCGTCAGGATGTCATGGTTCATCTCGAGATGAACCATGACATCCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-2736s1c1
Sequence:CCGGCATCCACTTCCCACCTAATATCTCGAGATATTAGGTGGGAAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-1182s1c1
Sequence:CCGGCCCACTATACCTGGAAAGGTTCTCGAGAACCTTTCCAGGTATAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177897.3-736s1c2
Sequence:CCGGGAACTGCTCCACAAGCAAGATCTCGAGATCTTGCTTGTGGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks