EMAIL THIS PAGE TO A FRIEND

B4GALT1

UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1

171 Gene Product Result for
Synonyms: B4GAL-T1 CDG2D GGTB2 GT1 GTB beta4Gal-T1
Gene ID:
Human(2683) Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene is unique among the beta4GalT genes because it encodes an enzyme that participates both in glycoconjugate and lactose biosynthesis. For the first activity, the enzyme adds galactose to N-acetylglucosamine residues that are either monosaccharides or the nonreducing ends of glycoprotein carbohydrate chains. The second activity is restricted to lactating mammary tissues where the enzyme forms a heterodimer with alpha-lactalbumin to catalyze UDP-galactose + D-glucose <=> UDP + lactose. The two enzymatic forms result from alternate transcription initiation sites and post-translational processing. Two transcripts, which differ only at the 5' end, with approximate lengths of 4.1 kb and 3.9 kb encode the same protein. The longer transcript encodes the type II membrane-bound, trans-Golgi resident protein involved in glycoconjugate biosynthesis. The shorter transcript encodes a protein which is cleaved to form the soluble lactose synthase. [provided by RefSeq, Jul 2008]
Mouse(14595) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Rat(24390) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
naked mole-rat(101721414) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Goat(100860927) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Domestic Rabbit(100345726) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
sheep(100620048) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Zebrafish(550425) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
dog(481579) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
cow(281781) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
chicken(396121) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1280 Human B4GalT1 ELISA for serum, plasma and cell culture supernatants human pricing

Activity Assay

Product # Description Species Add to Cart
 
CS1050 UDP-Galactosyltransferase Assay Kit sufficient for 100 tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001497 Rosetta Predictions human pricing
NM_053287 Rosetta Predictions rat pricing
NM_022305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080445 predicted 698
2 SASI_Hs01_00080446 predicted 1041
3 SASI_Hs02_00331988 predicted 1129
4 SASI_Hs01_00080447 predicted 591
5 SASI_Hs01_00080448 predicted 1215
6 SASI_Hs01_00080449 predicted 650
7 SASI_Hs01_00080450 predicted 641
8 SASI_Hs01_00080451 predicted 885
9 SASI_Hs01_00080452 predicted 1160
10 SASI_Hs01_00080453 predicted 738
11 SASI_Hs01_00080454 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265641 predicted 1014
2 SASI_Rn02_00265642 predicted 1359
3 SASI_Rn02_00265643 predicted 934
4 SASI_Rn02_00265644 predicted 843
5 SASI_Rn02_00265645 predicted 791
6 SASI_Rn02_00265646 predicted 1181
7 SASI_Rn02_00265647 predicted 1041
8 SASI_Rn02_00265648 predicted 1356
9 SASI_Rn02_00265649 predicted 550
10 SASI_Rn02_00265650 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097792 predicted 1333
2 SASI_Mm01_00097793 predicted 1016
3 SASI_Mm01_00097794 predicted 961
4 SASI_Mm01_00097795 predicted 1249
5 SASI_Mm01_00097796 predicted 716
6 SASI_Mm01_00097797 predicted 958
7 SASI_Mm01_00097798 predicted 862
8 SASI_Mm01_00097799 predicted 1173
9 SASI_Mm02_00326522 predicted 759
10 SASI_Mm01_00097800 predicted 815
11 SASI_Mm01_00097801 predicted 1262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001497
B4GALT1 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-943s1c1
Sequence:CCGGGCTCTAAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-825s1c1
Sequence:CCGGCATTCCAATGAATGACCATAACTCGAGTTATGGTCATTCATTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-532s1c1
Sequence:CCGGGTGGCAAAGCAGAACCCAAATCTCGAGATTTGGGTTCTGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-1046s1c1
Sequence:CCGGGCATGTCTATATCTCGCCCAACTCGAGTTGGGCGAGATATAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-742s1c1
Sequence:CCGGCGTGCTAAGCTCCTCAATGTTCTCGAGAACATTGAGGAGCTTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-649s21c1
Sequence:CCGGGTGGCAAAGCAGAACCCAAATCTCGAGATTTGGGTTCTGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-1060s21c1
Sequence:CCGGGCTCTAAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-834s21c1
Sequence:CCGGCCAGGCGGGAGACACTATATTCTCGAGAATATAGTGTCTCCCGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-759s21c1
Sequence:CCGGCCTCAAGTACTGGCTATATTACTCGAGTAATATAGCCAGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001497.3-1704s21c1
Sequence:CCGGATTGCTAAATTGTCGTGAAATCTCGAGATTTCACGACAATTTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001497
B4GALT1 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-943s1c1
Sequence:CCGGGCTCTAAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-825s1c1
Sequence:CCGGCATTCCAATGAATGACCATAACTCGAGTTATGGTCATTCATTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-532s1c1
Sequence:CCGGGTGGCAAAGCAGAACCCAAATCTCGAGATTTGGGTTCTGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-1046s1c1
Sequence:CCGGGCATGTCTATATCTCGCCCAACTCGAGTTGGGCGAGATATAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-742s1c1
Sequence:CCGGCGTGCTAAGCTCCTCAATGTTCTCGAGAACATTGAGGAGCTTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-649s21c1
Sequence:CCGGGTGGCAAAGCAGAACCCAAATCTCGAGATTTGGGTTCTGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-1060s21c1
Sequence:CCGGGCTCTAAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-834s21c1
Sequence:CCGGCCAGGCGGGAGACACTATATTCTCGAGAATATAGTGTCTCCCGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-759s21c1
Sequence:CCGGCCTCAAGTACTGGCTATATTACTCGAGTAATATAGCCAGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001497.3-1704s21c1
Sequence:CCGGATTGCTAAATTGTCGTGAAATCTCGAGATTTCACGACAATTTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001497
B4GALT1 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-943s1c1
Sequence:CCGGGCTCTAAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-825s1c1
Sequence:CCGGCATTCCAATGAATGACCATAACTCGAGTTATGGTCATTCATTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-532s1c1
Sequence:CCGGGTGGCAAAGCAGAACCCAAATCTCGAGATTTGGGTTCTGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-1046s1c1
Sequence:CCGGGCATGTCTATATCTCGCCCAACTCGAGTTGGGCGAGATATAGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001497.2-742s1c1
Sequence:CCGGCGTGCTAAGCTCCTCAATGTTCTCGAGAACATTGAGGAGCTTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-649s21c1
Sequence:CCGGGTGGCAAAGCAGAACCCAAATCTCGAGATTTGGGTTCTGCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-1060s21c1
Sequence:CCGGGCTCTAAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-834s21c1
Sequence:CCGGCCAGGCGGGAGACACTATATTCTCGAGAATATAGTGTCTCCCGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001497.3-759s21c1
Sequence:CCGGCCTCAAGTACTGGCTATATTACTCGAGTAATATAGCCAGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001497.3-1704s21c1
Sequence:CCGGATTGCTAAATTGTCGTGAAATCTCGAGATTTCACGACAATTTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022305
VALIDATED
B4GALT1 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1337s1c1
Sequence:CCGGGTACAGAGATACCCGTTATATCTCGAGATATAACGGGTATCTCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1067s1c1
Sequence:CCGGGCTCTCAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1170s1c1
Sequence:CCGGGCATGTCTATATCACGTCCAACTCGAGTTGGACGTGATATAGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022305.2-1010s1c1
Sequence:CCGGGCAATGGACAAGTTCGGGTTTCTCGAGAAACCCGAACTTGTCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-614s1c1
Sequence:CCGGCCCATGCTGATTGACTTTAATCTCGAGATTAAAGTCAATCAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022305
VALIDATED
B4GALT1 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1337s1c1
Sequence:CCGGGTACAGAGATACCCGTTATATCTCGAGATATAACGGGTATCTCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1067s1c1
Sequence:CCGGGCTCTCAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1170s1c1
Sequence:CCGGGCATGTCTATATCACGTCCAACTCGAGTTGGACGTGATATAGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022305.2-1010s1c1
Sequence:CCGGGCAATGGACAAGTTCGGGTTTCTCGAGAAACCCGAACTTGTCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-614s1c1
Sequence:CCGGCCCATGCTGATTGACTTTAATCTCGAGATTAAAGTCAATCAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022305
VALIDATED
B4GALT1 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1337s1c1
Sequence:CCGGGTACAGAGATACCCGTTATATCTCGAGATATAACGGGTATCTCTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1067s1c1
Sequence:CCGGGCTCTCAGTAAACAACAGTTTCTCGAGAAACTGTTGTTTACTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-1170s1c1
Sequence:CCGGGCATGTCTATATCACGTCCAACTCGAGTTGGACGTGATATAGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022305.2-1010s1c1
Sequence:CCGGGCAATGGACAAGTTCGGGTTTCTCGAGAAACCCGAACTTGTCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022305.2-614s1c1
Sequence:CCGGCCCATGCTGATTGACTTTAATCTCGAGATTAAAGTCAATCAGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks