EMAIL THIS PAGE TO A FRIEND

B4GALT2

UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2

111 Gene Product Result for
Synonyms: B4Gal-T2 B4Gal-T3 beta4Gal-T2
Gene ID:
Human(8704) Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(53418) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Rat(313536) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
chicken(396122) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
cow(100125390) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
domestic cat(101084809) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Horse(100066149) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
dog(482527) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
sheep(101114825) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Domestic Rabbit(100351419) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
domestic guinea pig(100724702) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
naked mole-rat(101718811) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003780 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060931 MISSION® esiRNA esiRNA human B4GALT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005417 Rosetta Predictions human pricing
NM_003780 Rosetta Predictions human pricing
NM_001107965 Rosetta Predictions rat pricing
NM_017377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078382 predicted 1165
2 SASI_Hs01_00078383 predicted 857
3 SASI_Hs01_00078384 predicted 1104
4 SASI_Hs01_00078385 predicted 1201
5 SASI_Hs01_00078386 predicted 629
6 SASI_Hs01_00078387 predicted 1207
7 SASI_Hs01_00078388 predicted 914
8 SASI_Hs01_00078389 predicted 1119
9 SASI_Hs02_00304922 predicted 818
10 SASI_Hs01_00078390 predicted 1016
11 SASI_Hs01_00078391 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241801 predicted 1377
2 SASI_Hs01_00241802 predicted 1070
3 SASI_Hs01_00241803 predicted 1315
4 SASI_Hs01_00241804 predicted 1417
5 SASI_Hs01_00241805 predicted 842
6 SASI_Hs01_00241806 predicted 1421
7 SASI_Hs01_00241807 predicted 1134
8 SASI_Hs01_00241808 predicted 1329
9 SASI_Hs02_00336282 predicted 1029
10 SASI_Hs01_00241809 predicted 1232
11 SASI_Hs01_00241810 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234035 predicted 1438
2 SASI_Rn02_00234036 predicted 649
3 SASI_Rn02_00234037 predicted 793
4 SASI_Rn02_00234038 predicted 1079
5 SASI_Rn02_00234039 predicted 1310
6 SASI_Rn02_00234040 predicted 600
7 SASI_Rn02_00234041 predicted 885
8 SASI_Rn02_00234042 predicted 1191
9 SASI_Rn02_00234043 predicted 832
10 SASI_Rn02_00234044 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149287 predicted 1352
2 SASI_Mm01_00149288 predicted 923
3 SASI_Mm01_00149289 predicted 1147
4 SASI_Mm01_00149291 predicted 875
5 SASI_Mm01_00149292 predicted 1459
6 SASI_Mm01_00149293 predicted 1539
7 SASI_Mm01_00149294 predicted 1109
8 SASI_Mm01_00149295 predicted 1713
9 SASI_Mm01_00149296 predicted 539
10 SASI_Mm02_00323870 predicted 1073
11 SASI_Mm01_00149290 predicted 1676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017377
VALIDATED
B4GALT2 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1408s21c1
Sequence:CCGGCCCAACCCTCAGAGGTTTAATCTCGAGATTAAACCTCTGAGGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1196s21c1
Sequence:CCGGTGCCCTATGCTAGCTACTTTGCTCGAGCAAAGTAGCTAGCATAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1241s21c1
Sequence:CCGGCCCAGTTTCTGAGGATCAATGCTCGAGCATTGATCCTCAGAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1724s21c1
Sequence:CCGGGAAGTTCCAGCATTCACTTTGCTCGAGCAAAGTGAATGCTGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017377.1-431s1c1
Sequence:CCGGCATCGAATTCACCTCACCCATCTCGAGATGGGTGAGGTGAATTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-1065s1c1
Sequence:CCGGCCTCAGAGGTTTAATAAGATTCTCGAGAATCTTATTAAACCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-1059s1c1
Sequence:CCGGCCCAACCCTCAGAGGTTTAATCTCGAGATTAAACCTCTGAGGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-576s1c1
Sequence:CCGGCTACGCTATTGGCTCCACTATCTCGAGATAGTGGAGCCAATAGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-891s1c1
Sequence:CCGGGCCCAGTTTCTGAGGATCAATCTCGAGATTGATCCTCAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017377
VALIDATED
B4GALT2 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1408s21c1
Sequence:CCGGCCCAACCCTCAGAGGTTTAATCTCGAGATTAAACCTCTGAGGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1196s21c1
Sequence:CCGGTGCCCTATGCTAGCTACTTTGCTCGAGCAAAGTAGCTAGCATAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1241s21c1
Sequence:CCGGCCCAGTTTCTGAGGATCAATGCTCGAGCATTGATCCTCAGAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1724s21c1
Sequence:CCGGGAAGTTCCAGCATTCACTTTGCTCGAGCAAAGTGAATGCTGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017377.1-431s1c1
Sequence:CCGGCATCGAATTCACCTCACCCATCTCGAGATGGGTGAGGTGAATTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-1065s1c1
Sequence:CCGGCCTCAGAGGTTTAATAAGATTCTCGAGAATCTTATTAAACCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-1059s1c1
Sequence:CCGGCCCAACCCTCAGAGGTTTAATCTCGAGATTAAACCTCTGAGGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-576s1c1
Sequence:CCGGCTACGCTATTGGCTCCACTATCTCGAGATAGTGGAGCCAATAGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-891s1c1
Sequence:CCGGGCCCAGTTTCTGAGGATCAATCTCGAGATTGATCCTCAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017377
VALIDATED
B4GALT2 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1408s21c1
Sequence:CCGGCCCAACCCTCAGAGGTTTAATCTCGAGATTAAACCTCTGAGGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1196s21c1
Sequence:CCGGTGCCCTATGCTAGCTACTTTGCTCGAGCAAAGTAGCTAGCATAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1241s21c1
Sequence:CCGGCCCAGTTTCTGAGGATCAATGCTCGAGCATTGATCCTCAGAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328976    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017377.4-1724s21c1
Sequence:CCGGGAAGTTCCAGCATTCACTTTGCTCGAGCAAAGTGAATGCTGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017377.1-431s1c1
Sequence:CCGGCATCGAATTCACCTCACCCATCTCGAGATGGGTGAGGTGAATTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-1065s1c1
Sequence:CCGGCCTCAGAGGTTTAATAAGATTCTCGAGAATCTTATTAAACCTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-1059s1c1
Sequence:CCGGCCCAACCCTCAGAGGTTTAATCTCGAGATTAAACCTCTGAGGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-576s1c1
Sequence:CCGGCTACGCTATTGGCTCCACTATCTCGAGATAGTGGAGCCAATAGCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017377.1-891s1c1
Sequence:CCGGGCCCAGTTTCTGAGGATCAATCTCGAGATTGATCCTCAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003780
VALIDATED
B4GALT2 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-454s21c1
Sequence:CCGGCATCCTCTACTTTGACGTCTACTCGAGTAGACGTCAAAGTAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1082s21c1
Sequence:CCGGGCCATTGCCATGGACAAGTTTCTCGAGAAACTTGTCCATGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-895s21c1
Sequence:CCGGCTACGGCGTCTATGTCATCAACTCGAGTTGATGACATAGACGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1423s21c1
Sequence:CCGGGCAACCACTCTTCACCAATATCTCGAGATATTGGTGAAGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1308s21c1
Sequence:CCGGGCGACAAGCATAACGAACCTACTCGAGTAGGTTCGTTATGCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-1105s1c1
Sequence:CCGGGCAACCACTCTTCACCAATATCTCGAGATATTGGTGAAGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-990s1c1
Sequence:CCGGGCGACAAGCATAACGAACCTACTCGAGTAGGTTCGTTATGCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-577s1c1
Sequence:CCGGCTACGGCGTCTATGTCATCAACTCGAGTTGATGACATAGACGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-136s1c1
Sequence:CCGGCATCCTCTACTTTGACGTCTACTCGAGTAGACGTCAAAGTAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003780
VALIDATED
B4GALT2 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-454s21c1
Sequence:CCGGCATCCTCTACTTTGACGTCTACTCGAGTAGACGTCAAAGTAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1082s21c1
Sequence:CCGGGCCATTGCCATGGACAAGTTTCTCGAGAAACTTGTCCATGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-895s21c1
Sequence:CCGGCTACGGCGTCTATGTCATCAACTCGAGTTGATGACATAGACGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1423s21c1
Sequence:CCGGGCAACCACTCTTCACCAATATCTCGAGATATTGGTGAAGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1308s21c1
Sequence:CCGGGCGACAAGCATAACGAACCTACTCGAGTAGGTTCGTTATGCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-1105s1c1
Sequence:CCGGGCAACCACTCTTCACCAATATCTCGAGATATTGGTGAAGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-990s1c1
Sequence:CCGGGCGACAAGCATAACGAACCTACTCGAGTAGGTTCGTTATGCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-577s1c1
Sequence:CCGGCTACGGCGTCTATGTCATCAACTCGAGTTGATGACATAGACGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-136s1c1
Sequence:CCGGCATCCTCTACTTTGACGTCTACTCGAGTAGACGTCAAAGTAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003780
VALIDATED
B4GALT2 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-454s21c1
Sequence:CCGGCATCCTCTACTTTGACGTCTACTCGAGTAGACGTCAAAGTAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1082s21c1
Sequence:CCGGGCCATTGCCATGGACAAGTTTCTCGAGAAACTTGTCCATGGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-895s21c1
Sequence:CCGGCTACGGCGTCTATGTCATCAACTCGAGTTGATGACATAGACGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1423s21c1
Sequence:CCGGGCAACCACTCTTCACCAATATCTCGAGATATTGGTGAAGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003780.3-1308s21c1
Sequence:CCGGGCGACAAGCATAACGAACCTACTCGAGTAGGTTCGTTATGCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-1105s1c1
Sequence:CCGGGCAACCACTCTTCACCAATATCTCGAGATATTGGTGAAGAGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-990s1c1
Sequence:CCGGGCGACAAGCATAACGAACCTACTCGAGTAGGTTCGTTATGCTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-577s1c1
Sequence:CCGGCTACGGCGTCTATGTCATCAACTCGAGTTGATGACATAGACGCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003780.2-136s1c1
Sequence:CCGGCATCCTCTACTTTGACGTCTACTCGAGTAGACGTCAAAGTAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks