EMAIL THIS PAGE TO A FRIEND

B4GALT3

UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3

96 Gene Product Result for
Synonyms: beta4Gal-T3
UniProtKB ID: O60512, D3DVG3, O60910, Q9BPZ4, Q9H8T2
Gene ID:
Human(8703) Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(57370) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Rat(494342) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
naked mole-rat(101702700) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
domestic guinea pig(100712729) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
sheep(101103686) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Domestic Rabbit(100358436) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
chicken(418342) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
cow(515771) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
domestic cat(101089738) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
dog(488650) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003779 Rosetta Predictions human pricing
NM_001009539 Rosetta Predictions rat pricing
NM_020579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047990 predicted 1107
2 SASI_Hs01_00047991 predicted 500
3 SASI_Hs01_00047992 predicted 968
4 SASI_Hs02_00336281 predicted 551
5 SASI_Hs01_00047993 predicted 1451
6 SASI_Hs01_00047994 predicted 912
7 SASI_Hs01_00047995 predicted 372
8 SASI_Hs01_00047996 predicted 1133
9 SASI_Hs01_00047997 predicted 1207
10 SASI_Hs01_00047998 predicted 394
11 SASI_Hs01_00047999 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070380 predicted 1227
2 SASI_Rn01_00070381 predicted 572
3 SASI_Rn01_00070382 predicted 1122
4 SASI_Rn01_00070383 predicted 1546
5 SASI_Rn01_00070384 predicted 932
6 SASI_Rn01_00070385 predicted 540
7 SASI_Rn02_00199599 predicted 766
8 SASI_Rn01_00070386 predicted 880
9 SASI_Rn01_00070388 predicted 735
10 SASI_Rn01_00070389 predicted 1257
11 SASI_Rn01_00070387 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047093 predicted 890
2 SASI_Mm01_00047095 predicted 1087
3 SASI_Mm01_00047096 predicted 721
4 SASI_Mm01_00047097 predicted 480
5 SASI_Mm01_00047098 predicted 501
6 SASI_Mm02_00325646 predicted 1190
7 SASI_Mm01_00047099 predicted 707
8 SASI_Mm02_00325647 predicted 1163
9 SASI_Mm01_00047100 predicted 389
10 SASI_Mm01_00047101 predicted 1506
11 SASI_Mm01_00047094 predicted 1420
12 SASI_Mm01_00047102 predicted 1510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003779
VALIDATED
B4GALT3 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-1101s1c1
Sequence:CCGGCCACATCTGTAGGACACTATACTCGAGTATAGTGTCCTACAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-748s1c1
Sequence:CCGGCCAGGCTGGAAATGGAACATTCTCGAGAATGTTCCATTTCCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-356s1c1
Sequence:CCGGCGAAGTCTCAGTGCCCTATTTCTCGAGAAATAGGGCACTGAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003779.2-356s21c1
Sequence:CCGGCGAAGTCTCAGTGCCCTATTTCTCGAGAAATAGGGCACTGAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1635s21c1
Sequence:CCGGAGGGTCTCCTGTAGGGCTTATCTCGAGATAAGCCCTACAGGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1102s21c1
Sequence:CCGGCACATCTGTAGGACACTATAACTCGAGTTATAGTGTCCTACAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1038s21c1
Sequence:CCGGGTGGTGAGGATGACGACATTGCTCGAGCAATGTCGTCATCCTCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-380s21c1
Sequence:CCGGCGAGATCAGGGACCGACATTTCTCGAGAAATGTCGGTCCCTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003779
VALIDATED
B4GALT3 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-1101s1c1
Sequence:CCGGCCACATCTGTAGGACACTATACTCGAGTATAGTGTCCTACAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-748s1c1
Sequence:CCGGCCAGGCTGGAAATGGAACATTCTCGAGAATGTTCCATTTCCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-356s1c1
Sequence:CCGGCGAAGTCTCAGTGCCCTATTTCTCGAGAAATAGGGCACTGAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003779.2-356s21c1
Sequence:CCGGCGAAGTCTCAGTGCCCTATTTCTCGAGAAATAGGGCACTGAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1635s21c1
Sequence:CCGGAGGGTCTCCTGTAGGGCTTATCTCGAGATAAGCCCTACAGGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1102s21c1
Sequence:CCGGCACATCTGTAGGACACTATAACTCGAGTTATAGTGTCCTACAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1038s21c1
Sequence:CCGGGTGGTGAGGATGACGACATTGCTCGAGCAATGTCGTCATCCTCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-380s21c1
Sequence:CCGGCGAGATCAGGGACCGACATTTCTCGAGAAATGTCGGTCCCTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003779
VALIDATED
B4GALT3 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-1101s1c1
Sequence:CCGGCCACATCTGTAGGACACTATACTCGAGTATAGTGTCCTACAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-748s1c1
Sequence:CCGGCCAGGCTGGAAATGGAACATTCTCGAGAATGTTCCATTTCCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003779.2-356s1c1
Sequence:CCGGCGAAGTCTCAGTGCCCTATTTCTCGAGAAATAGGGCACTGAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003779.2-356s21c1
Sequence:CCGGCGAAGTCTCAGTGCCCTATTTCTCGAGAAATAGGGCACTGAGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1635s21c1
Sequence:CCGGAGGGTCTCCTGTAGGGCTTATCTCGAGATAAGCCCTACAGGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1102s21c1
Sequence:CCGGCACATCTGTAGGACACTATAACTCGAGTTATAGTGTCCTACAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-1038s21c1
Sequence:CCGGGTGGTGAGGATGACGACATTGCTCGAGCAATGTCGTCATCCTCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003779.2-380s21c1
Sequence:CCGGCGAGATCAGGGACCGACATTTCTCGAGAAATGTCGGTCCCTGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020579
VALIDATED
B4GALT3 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-1628s1c1
Sequence:CCGGCTGTGAATCTTTGATGTCATTCTCGAGAATGACATCAAAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-472s1c1
Sequence:CCGGCCAGAAAGATCACCCTTCTTACTCGAGTAAGAAGGGTGATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020579.1-364s1c1
Sequence:CCGGCCAACATTCGACTATTCTCATCTCGAGATGAGAATAGTCGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-1237s1c1
Sequence:CCGGCCTCTCTATACCAACATCACTCTCGAGAGTGATGTTGGTATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-993s21c1
Sequence:CCGGCCAGTACTTTGGCGGAGTTTCCTCGAGGAAACTCCGCCAAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020579.1-888s1c2
Sequence:CCGGCGTTGCTGTTGCCATGAACAACTCGAGTTGTTCATGGCAACAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020579.2-1688s21c1
Sequence:CCGGCTGTGAATCTTTGATGTCATTCTCGAGAATGACATCAAAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-665s21c1
Sequence:CCGGGCTCCCGAACAGCCATAATTGCTCGAGCAATTATGGCTGTTCGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020579.2-532s21c1
Sequence:CCGGCCAGAAAGATCACCCTTCTTACTCGAGTAAGAAGGGTGATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-424s21c1
Sequence:CCGGCCAACATTCGACTATTCTCATCTCGAGATGAGAATAGTCGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020579
VALIDATED
B4GALT3 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-1628s1c1
Sequence:CCGGCTGTGAATCTTTGATGTCATTCTCGAGAATGACATCAAAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-472s1c1
Sequence:CCGGCCAGAAAGATCACCCTTCTTACTCGAGTAAGAAGGGTGATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020579.1-364s1c1
Sequence:CCGGCCAACATTCGACTATTCTCATCTCGAGATGAGAATAGTCGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-1237s1c1
Sequence:CCGGCCTCTCTATACCAACATCACTCTCGAGAGTGATGTTGGTATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-993s21c1
Sequence:CCGGCCAGTACTTTGGCGGAGTTTCCTCGAGGAAACTCCGCCAAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020579.1-888s1c2
Sequence:CCGGCGTTGCTGTTGCCATGAACAACTCGAGTTGTTCATGGCAACAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020579.2-1688s21c1
Sequence:CCGGCTGTGAATCTTTGATGTCATTCTCGAGAATGACATCAAAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-665s21c1
Sequence:CCGGGCTCCCGAACAGCCATAATTGCTCGAGCAATTATGGCTGTTCGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020579.2-532s21c1
Sequence:CCGGCCAGAAAGATCACCCTTCTTACTCGAGTAAGAAGGGTGATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-424s21c1
Sequence:CCGGCCAACATTCGACTATTCTCATCTCGAGATGAGAATAGTCGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020579
VALIDATED
B4GALT3 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-1628s1c1
Sequence:CCGGCTGTGAATCTTTGATGTCATTCTCGAGAATGACATCAAAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-472s1c1
Sequence:CCGGCCAGAAAGATCACCCTTCTTACTCGAGTAAGAAGGGTGATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020579.1-364s1c1
Sequence:CCGGCCAACATTCGACTATTCTCATCTCGAGATGAGAATAGTCGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020579.1-1237s1c1
Sequence:CCGGCCTCTCTATACCAACATCACTCTCGAGAGTGATGTTGGTATAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-993s21c1
Sequence:CCGGCCAGTACTTTGGCGGAGTTTCCTCGAGGAAACTCCGCCAAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020579.1-888s1c2
Sequence:CCGGCGTTGCTGTTGCCATGAACAACTCGAGTTGTTCATGGCAACAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020579.2-1688s21c1
Sequence:CCGGCTGTGAATCTTTGATGTCATTCTCGAGAATGACATCAAAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-665s21c1
Sequence:CCGGGCTCCCGAACAGCCATAATTGCTCGAGCAATTATGGCTGTTCGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020579.2-532s21c1
Sequence:CCGGCCAGAAAGATCACCCTTCTTACTCGAGTAAGAAGGGTGATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020579.2-424s21c1
Sequence:CCGGCCAACATTCGACTATTCTCATCTCGAGATGAGAATAGTCGAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks