EMAIL THIS PAGE TO A FRIEND

B4GALT4

UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4

Synonyms: B4Gal-T4 beta4Gal-T4
UniProtKB ID: O60513, Q68D68, Q9BSW3, Q9C078
Gene ID:
Human(8702) Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56375) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Rat(303923) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Zebrafish(492760) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
chicken(418341) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
domestic cat(101100325) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
cow(511328) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
dog(608143) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
sheep(101104949) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
domestic guinea pig(100735550) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
naked mole-rat(101723638) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003778 Rosetta Predictions human pricing
NM_212543 Rosetta Predictions human pricing
NM_001012018 Rosetta Predictions rat pricing
XM_573289 Rosetta Predictions rat pricing
NM_019804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173377 predicted 1521
2 SASI_Hs01_00173378 predicted 523
3 SASI_Hs01_00173379 predicted 1297
4 SASI_Hs01_00173380 predicted 939
5 SASI_Hs02_00336278 predicted 1313
6 SASI_Hs01_00173382 predicted 1323
7 SASI_Hs02_00336279 predicted 815
8 SASI_Hs01_00173383 predicted 1510
9 SASI_Hs02_00336280 predicted 1286
10 SASI_Hs01_00173385 predicted 600
11 SASI_Hs01_00173376 predicted 512
12 SASI_Hs01_00173381 predicted 1152
13 SASI_Hs01_00173384 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014584 predicted 1601
2 SASI_Hs01_00014585 predicted 606
3 SASI_Hs01_00014586 predicted 1381
4 SASI_Hs01_00014587 predicted 1017
5 SASI_Hs02_00374216 predicted 1402
6 SASI_Hs01_00014589 predicted 1403
7 SASI_Hs02_00374217 predicted 892
8 SASI_Hs01_00014590 predicted 1595
9 SASI_Hs02_00374218 predicted 1370
10 SASI_Hs01_00014592 predicted 690
11 SASI_Hs01_00014583 predicted 601
12 SASI_Hs01_00014588 predicted 1237
13 SASI_Hs01_00014591 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092665 predicted 1362
2 SASI_Rn01_00092668 predicted 1136
3 SASI_Rn01_00092669 predicted 332
4 SASI_Rn01_00092670 predicted 629
5 SASI_Rn02_00200099 predicted 1180
6 SASI_Rn01_00092671 predicted 1106
7 SASI_Rn02_00200100 predicted 367
8 SASI_Rn01_00092672 predicted 967
9 SASI_Rn01_00092673 predicted 1233
10 SASI_Rn02_00200101 predicted 381
11 SASI_Rn01_00092666 predicted 291
12 SASI_Rn01_00092667 predicted 381
13 SASI_Rn01_00092674 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163795 predicted 1369
2 SASI_Rn01_00163796 predicted 291
3 SASI_Rn01_00163797 predicted 373
4 SASI_Rn01_00163798 predicted 1146
5 SASI_Rn01_00163799 predicted 336
6 SASI_Rn01_00163800 predicted 642
7 SASI_Rn01_00163801 predicted 1112
8 SASI_Rn01_00163802 predicted 980
9 SASI_Rn01_00163803 predicted 1246
10 SASI_Rn01_00163804 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139187 predicted 1374
2 SASI_Mm01_00139188 predicted 390
3 SASI_Mm01_00139189 predicted 841
4 SASI_Mm01_00139190 predicted 869
5 SASI_Mm01_00139191 predicted 288
6 SASI_Mm01_00139192 predicted 1196
7 SASI_Mm01_00139193 predicted 1349
8 SASI_Mm01_00139194 predicted 258
9 SASI_Mm01_00139195 predicted 1116
10 SASI_Mm01_00139196 predicted 978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003778
B4GALT4 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003778.3-1684s21c1
Sequence:CCGGATGGATACTTGAAGGACTTTACTCGAGTAAAGTCCTTCAAGTATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-907s1c1
Sequence:CCGGCGAGAATGACTTTAACCTTTACTCGAGTAAAGGTTAAAGTCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-985s1c1
Sequence:CCGGGTTACGTTACAGTGGATATTTCTCGAGAAATATCCACTGTAACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-1141s1c1
Sequence:CCGGCCTGCCTGAAGTGGGTAAATACTCGAGTATTTACCCACTTCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-1211s1c1
Sequence:CCGGCGGATGAAGCTCTTACACCAACTCGAGTTGGTGTAAGAGCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003778
B4GALT4 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003778.3-1684s21c1
Sequence:CCGGATGGATACTTGAAGGACTTTACTCGAGTAAAGTCCTTCAAGTATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-907s1c1
Sequence:CCGGCGAGAATGACTTTAACCTTTACTCGAGTAAAGGTTAAAGTCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-985s1c1
Sequence:CCGGGTTACGTTACAGTGGATATTTCTCGAGAAATATCCACTGTAACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-1141s1c1
Sequence:CCGGCCTGCCTGAAGTGGGTAAATACTCGAGTATTTACCCACTTCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-1211s1c1
Sequence:CCGGCGGATGAAGCTCTTACACCAACTCGAGTTGGTGTAAGAGCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003778
B4GALT4 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003778.3-1684s21c1
Sequence:CCGGATGGATACTTGAAGGACTTTACTCGAGTAAAGTCCTTCAAGTATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-907s1c1
Sequence:CCGGCGAGAATGACTTTAACCTTTACTCGAGTAAAGGTTAAAGTCATTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-985s1c1
Sequence:CCGGGTTACGTTACAGTGGATATTTCTCGAGAAATATCCACTGTAACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-1141s1c1
Sequence:CCGGCCTGCCTGAAGTGGGTAAATACTCGAGTATTTACCCACTTCAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003778.2-1211s1c1
Sequence:CCGGCGGATGAAGCTCTTACACCAACTCGAGTTGGTGTAAGAGCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019804
B4GALT4 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-377s1c1
Sequence:CCGGGCTAGTTTCCACAAGGTCATACTCGAGTATGACCTTGTGGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-1216s1c1
Sequence:CCGGGCACAACCCTTTATATGCCAACTCGAGTTGGCATATAAAGGGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-688s1c1
Sequence:CCGGGCTGGACTACGGCATCTATATCTCGAGATATAGATGCCGTAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-970s1c1
Sequence:CCGGGAATGGATTCTCTAACAACTACTCGAGTAGTTGTTAGAGAATCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-1072s1c1
Sequence:CCGGCGTGGGCAAATACACCATGATCTCGAGATCATGGTGTATTTGCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019804
B4GALT4 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-377s1c1
Sequence:CCGGGCTAGTTTCCACAAGGTCATACTCGAGTATGACCTTGTGGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-1216s1c1
Sequence:CCGGGCACAACCCTTTATATGCCAACTCGAGTTGGCATATAAAGGGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-688s1c1
Sequence:CCGGGCTGGACTACGGCATCTATATCTCGAGATATAGATGCCGTAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-970s1c1
Sequence:CCGGGAATGGATTCTCTAACAACTACTCGAGTAGTTGTTAGAGAATCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-1072s1c1
Sequence:CCGGCGTGGGCAAATACACCATGATCTCGAGATCATGGTGTATTTGCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019804
B4GALT4 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-377s1c1
Sequence:CCGGGCTAGTTTCCACAAGGTCATACTCGAGTATGACCTTGTGGAAACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-1216s1c1
Sequence:CCGGGCACAACCCTTTATATGCCAACTCGAGTTGGCATATAAAGGGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-688s1c1
Sequence:CCGGGCTGGACTACGGCATCTATATCTCGAGATATAGATGCCGTAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-970s1c1
Sequence:CCGGGAATGGATTCTCTAACAACTACTCGAGTAGTTGTTAGAGAATCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019804.1-1072s1c1
Sequence:CCGGCGTGGGCAAATACACCATGATCTCGAGATCATGGTGTATTTGCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks