EMAIL THIS PAGE TO A FRIEND

B4GALT5

UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5

137 Gene Product Result for
Synonyms: B4Gal-T5 BETA4-GALT-IV beta4Gal-T5 beta4GalT-V gt-V
UniProtKB ID: O43286, E1P625, Q2M394, Q9UJQ8
Gene ID:
Human(9334) Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The function of the enzyme encoded by this gene is not clear. This gene was previously designated as B4GALT4 but was renamed to B4GALT5. In the literature it is also referred to as beta4GalT2. [provided by RefSeq, Jul 2008]
Mouse(56336) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Rat(362275) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Zebrafish(724080) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
cow(282407) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
dog(485920) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
domestic cat(101081792) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
chicken(419358) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
naked mole-rat(101699877) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
domestic guinea pig(100734895) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
sheep(101116670) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Domestic Rabbit(100351465) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004776 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004776 Rosetta Predictions human pricing
NM_001108608 Rosetta Predictions rat pricing
NM_019835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010221 predicted 1017
2 SASI_Hs01_00010222 predicted 903
3 SASI_Hs02_00338284 predicted 574
4 SASI_Hs01_00010223 predicted 580
5 SASI_Hs01_00010224 predicted 843
6 SASI_Hs01_00010225 predicted 505
7 SASI_Hs01_00010226 predicted 561
8 SASI_Hs01_00010227 predicted 545
9 SASI_Hs01_00010228 predicted 561
10 SASI_Hs01_00010230 predicted 992
11 SASI_Hs01_00010229 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240309 predicted 253
2 SASI_Rn02_00240310 predicted 281
3 SASI_Rn02_00240311 predicted 355
4 SASI_Rn02_00240312 predicted 758
5 SASI_Rn02_00240313 predicted 179
6 SASI_Rn02_00240314 predicted 827
7 SASI_Rn02_00240315 predicted 114
8 SASI_Rn02_00240316 predicted 118
9 SASI_Rn02_00240317 predicted 281
10 SASI_Rn02_00240318 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134140 predicted 1265
2 SASI_Mm01_00134141 predicted 526
3 SASI_Mm01_00134142 predicted 382
4 SASI_Mm01_00134143 predicted 1209
5 SASI_Mm01_00134144 predicted 387
6 SASI_Mm01_00134145 predicted 1304
7 SASI_Mm01_00134146 predicted 378
8 SASI_Mm01_00134147 predicted 582
9 SASI_Mm01_00134149 predicted 728
10 SASI_Mm02_00325141 predicted 760
11 SASI_Mm01_00134148 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004776
B4GALT5 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-828s1c1
Sequence:CCGGCGGAAAGTGATCGCAACTATTCTCGAGAATAGTTGCGATCACTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-939s1c1
Sequence:CCGGGTGGCTTAACAGTGGAACAATCTCGAGATTGTTCCACTGTTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-1177s1c1
Sequence:CCGGCCTCAACAACCTGAACTACTTCTCGAGAAGTAGTTCAGGTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-727s1c1
Sequence:CCGGCCAACCCTTTAATCGAGCCATCTCGAGATGGCTCGATTAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-345s1c1
Sequence:CCGGGCAGTGTAAATGACTCAGATTCTCGAGAATCTGAGTCATTTACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004776.3-938s21c1
Sequence:CCGGTGGACAGATGCCGAGGCATTTCTCGAGAAATGCCTCGGCATCTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004776.3-677s21c1
Sequence:CCGGGTGGAAGGTGGCGATCCTTATCTCGAGATAAGGATCGCCACCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004776
B4GALT5 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-828s1c1
Sequence:CCGGCGGAAAGTGATCGCAACTATTCTCGAGAATAGTTGCGATCACTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-939s1c1
Sequence:CCGGGTGGCTTAACAGTGGAACAATCTCGAGATTGTTCCACTGTTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-1177s1c1
Sequence:CCGGCCTCAACAACCTGAACTACTTCTCGAGAAGTAGTTCAGGTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-727s1c1
Sequence:CCGGCCAACCCTTTAATCGAGCCATCTCGAGATGGCTCGATTAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-345s1c1
Sequence:CCGGGCAGTGTAAATGACTCAGATTCTCGAGAATCTGAGTCATTTACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004776.3-938s21c1
Sequence:CCGGTGGACAGATGCCGAGGCATTTCTCGAGAAATGCCTCGGCATCTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004776.3-677s21c1
Sequence:CCGGGTGGAAGGTGGCGATCCTTATCTCGAGATAAGGATCGCCACCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004776
B4GALT5 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-828s1c1
Sequence:CCGGCGGAAAGTGATCGCAACTATTCTCGAGAATAGTTGCGATCACTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-939s1c1
Sequence:CCGGGTGGCTTAACAGTGGAACAATCTCGAGATTGTTCCACTGTTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-1177s1c1
Sequence:CCGGCCTCAACAACCTGAACTACTTCTCGAGAAGTAGTTCAGGTTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-727s1c1
Sequence:CCGGCCAACCCTTTAATCGAGCCATCTCGAGATGGCTCGATTAAAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004776.2-345s1c1
Sequence:CCGGGCAGTGTAAATGACTCAGATTCTCGAGAATCTGAGTCATTTACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004776.3-938s21c1
Sequence:CCGGTGGACAGATGCCGAGGCATTTCTCGAGAAATGCCTCGGCATCTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004776.3-677s21c1
Sequence:CCGGGTGGAAGGTGGCGATCCTTATCTCGAGATAAGGATCGCCACCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019835
VALIDATED
B4GALT5 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-858s1c1
Sequence:CCGGCATACCTGAGAGTGACCGAAACTCGAGTTTCGGTCACTCTCAGGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019835.1-1218s1c1
Sequence:CCGGCAACCTGAACTACTCTGCGAACTCGAGTTCGCAGAGTAGTTCAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019835.1-258s1c1
Sequence:CCGGCATAGTGAACACCTACCTCTTCTCGAGAAGAGGTAGGTGTTCACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-733s1c1
Sequence:CCGGGCCTTCTATGTGATCGAGCAACTCGAGTTGCTCGATCACATAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-380s1c1
Sequence:CCGGGCAGCCTGAATGACTCAGATTCTCGAGAATCTGAGTCATTCAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019835
VALIDATED
B4GALT5 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-858s1c1
Sequence:CCGGCATACCTGAGAGTGACCGAAACTCGAGTTTCGGTCACTCTCAGGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019835.1-1218s1c1
Sequence:CCGGCAACCTGAACTACTCTGCGAACTCGAGTTCGCAGAGTAGTTCAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019835.1-258s1c1
Sequence:CCGGCATAGTGAACACCTACCTCTTCTCGAGAAGAGGTAGGTGTTCACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-733s1c1
Sequence:CCGGGCCTTCTATGTGATCGAGCAACTCGAGTTGCTCGATCACATAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-380s1c1
Sequence:CCGGGCAGCCTGAATGACTCAGATTCTCGAGAATCTGAGTCATTCAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019835
VALIDATED
B4GALT5 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-858s1c1
Sequence:CCGGCATACCTGAGAGTGACCGAAACTCGAGTTTCGGTCACTCTCAGGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019835.1-1218s1c1
Sequence:CCGGCAACCTGAACTACTCTGCGAACTCGAGTTCGCAGAGTAGTTCAGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019835.1-258s1c1
Sequence:CCGGCATAGTGAACACCTACCTCTTCTCGAGAAGAGGTAGGTGTTCACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-733s1c1
Sequence:CCGGGCCTTCTATGTGATCGAGCAACTCGAGTTGCTCGATCACATAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019835.1-380s1c1
Sequence:CCGGGCAGCCTGAATGACTCAGATTCTCGAGAATCTGAGTCATTCAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks