EMAIL THIS PAGE TO A FRIEND

B4GALT6

UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6

Synonyms: B4Gal-T6 beta4Gal-T6
UniProtKB ID: Q9UBX8, O60514
Gene ID:
Human(9331) Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene is a lactosylceramide synthase important for glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(56386) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
Rat(65196) UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
sheep(101114836) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Domestic Rabbit(100348067) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
domestic guinea pig(100715716) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
naked mole-rat(101726172) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Zebrafish(393912) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
cow(524460) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Horse(100052209) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
domestic cat(101088368) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
dog(490499) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
chicken(421092) UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004775 Rosetta Predictions human pricing
NM_031740 Rosetta Predictions rat pricing
XM_579528 Rosetta Predictions rat pricing
NM_019737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102580 predicted 356
2 SASI_Hs01_00102581 predicted 1360
3 SASI_Hs01_00102582 predicted 1253
4 SASI_Hs01_00102583 predicted 1139
5 SASI_Hs02_00338283 predicted 721
6 SASI_Hs01_00102584 predicted 1266
7 SASI_Hs01_00102585 predicted 462
8 SASI_Hs01_00102587 predicted 963
9 SASI_Hs01_00102588 predicted 1436
10 SASI_Hs01_00102589 predicted 587
11 SASI_Hs01_00102586 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265128 predicted 1020
2 SASI_Rn02_00265129 predicted 1857
3 SASI_Rn02_00265130 predicted 1946
4 SASI_Rn02_00265131 predicted 1743
5 SASI_Rn02_00265132 predicted 1602
6 SASI_Rn02_00265133 predicted 1872
7 SASI_Rn02_00265134 predicted 1538
8 SASI_Rn02_00265135 predicted 1168
9 SASI_Rn02_00265136 predicted 1085
10 SASI_Rn02_00265137 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00138756 predicted 1026
2 SASI_Rn01_00138757 predicted 1857
3 SASI_Rn01_00138758 predicted 1946
4 SASI_Rn01_00138759 predicted 1744
5 SASI_Rn01_00138760 predicted 1602
6 SASI_Rn01_00138761 predicted 1874
7 SASI_Rn01_00138762 predicted 1532
8 SASI_Rn01_00138763 predicted 1170
9 SASI_Rn01_00138764 predicted 1080
10 SASI_Rn01_00138765 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324881 predicted 974
2 SASI_Mm01_00141802 predicted 2059
3 SASI_Mm01_00141803 predicted 1010
4 SASI_Mm01_00141804 predicted 1113
5 SASI_Mm01_00141807 predicted 1295
6 SASI_Mm02_00324882 predicted 1178
7 SASI_Mm01_00141808 predicted 1694
8 SASI_Mm01_00141809 predicted 1927
9 SASI_Mm01_00141810 predicted 1474
10 SASI_Mm01_00141811 predicted 1391
11 SASI_Mm01_00141805 predicted 1699
12 SASI_Mm01_00141806 predicted 1839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004775
B4GALT6 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004775.3-1336s21c1
Sequence:CCGGATCGATGGACTGAACAATTTACTCGAGTAAATTGTTCAGTCCATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004775.3-1373s21c1
Sequence:CCGGTACTGGTTGATAGGTTGTATACTCGAGTATACAACCTATCAACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004775.3-1846s21c1
Sequence:CCGGATGTAATCGGTTATACCTTTACTCGAGTAAAGGTATAACCGATTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004775.3-1472s21c1
Sequence:CCGGGACCACAATGCTGGATCATAACTCGAGTTATGATCCAGCATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-572s1c1
Sequence:CCGGGCTGCCTTATATGCGAGGATTCTCGAGAATCCTCGCATATAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-738s1c1
Sequence:CCGGCGCCATGAACATCTTCCAATTCTCGAGAATTGGAAGATGTTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-1359s1c1
Sequence:CCGGCCAGAGTTAGCTCCAATCGAACTCGAGTTCGATTGGAGCTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-353s1c1
Sequence:CCGGCGCCAACACATATCTCTTTATCTCGAGATAAAGAGATATGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004775
B4GALT6 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004775.3-1336s21c1
Sequence:CCGGATCGATGGACTGAACAATTTACTCGAGTAAATTGTTCAGTCCATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004775.3-1373s21c1
Sequence:CCGGTACTGGTTGATAGGTTGTATACTCGAGTATACAACCTATCAACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004775.3-1846s21c1
Sequence:CCGGATGTAATCGGTTATACCTTTACTCGAGTAAAGGTATAACCGATTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004775.3-1472s21c1
Sequence:CCGGGACCACAATGCTGGATCATAACTCGAGTTATGATCCAGCATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-572s1c1
Sequence:CCGGGCTGCCTTATATGCGAGGATTCTCGAGAATCCTCGCATATAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-738s1c1
Sequence:CCGGCGCCATGAACATCTTCCAATTCTCGAGAATTGGAAGATGTTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-1359s1c1
Sequence:CCGGCCAGAGTTAGCTCCAATCGAACTCGAGTTCGATTGGAGCTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-353s1c1
Sequence:CCGGCGCCAACACATATCTCTTTATCTCGAGATAAAGAGATATGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004775
B4GALT6 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004775.3-1336s21c1
Sequence:CCGGATCGATGGACTGAACAATTTACTCGAGTAAATTGTTCAGTCCATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004775.3-1373s21c1
Sequence:CCGGTACTGGTTGATAGGTTGTATACTCGAGTATACAACCTATCAACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004775.3-1846s21c1
Sequence:CCGGATGTAATCGGTTATACCTTTACTCGAGTAAAGGTATAACCGATTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004775.3-1472s21c1
Sequence:CCGGGACCACAATGCTGGATCATAACTCGAGTTATGATCCAGCATTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-572s1c1
Sequence:CCGGGCTGCCTTATATGCGAGGATTCTCGAGAATCCTCGCATATAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-738s1c1
Sequence:CCGGCGCCATGAACATCTTCCAATTCTCGAGAATTGGAAGATGTTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-1359s1c1
Sequence:CCGGCCAGAGTTAGCTCCAATCGAACTCGAGTTCGATTGGAGCTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004775.2-353s1c1
Sequence:CCGGCGCCAACACATATCTCTTTATCTCGAGATAAAGAGATATGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019737
VALIDATED
B4GALT6 MISSION shRNA Bacterial Glycerol Stock
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-2065s21c1
Sequence:CCGGCTCCAATTGAAGACTATTAAACTCGAGTTTAATAGTCTTCAATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1923s21c1
Sequence:CCGGCAGTTCCTAGGACGGTATAAACTCGAGTTTATACCGTCCTAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1049s21c1
Sequence:CCGGCGCCAACACGTACCTCTTTATCTCGAGATAAAGAGGTACGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1976s21c1
Sequence:CCGGCGATGGACTGAACAATTTATTCTCGAGAATAAATTGTTCAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019737.1-1192s21c1
Sequence:CCGGGTGACTATCTTGTTCAAACAACTCGAGTTGTTTGAACAAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-2567s21c1
Sequence:CCGGAGGTTAAGCCTTGTGTCAAATCTCGAGATTTGACACAAGGCTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1049s1c1
Sequence:CCGGCGCCAACACGTACCTCTTTATCTCGAGATAAAGAGGTACGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1976s1c1
Sequence:CCGGCGATGGACTGAACAATTTATTCTCGAGAATAAATTGTTCAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1192s1c1
Sequence:CCGGGTGACTATCTTGTTCAAACAACTCGAGTTGTTTGAACAAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019737.1-1549s1c1
Sequence:CCGGCGATGCTCTTTAATGTGGGTTCTCGAGAACCCACATTAAAGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-3486s1c1
Sequence:CCGGGCCCAAATAGTGTTCTTACTTCTCGAGAAGTAAGAACACTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019737
VALIDATED
B4GALT6 MISSION shRNA shRNA Plasmid DNA
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-2065s21c1
Sequence:CCGGCTCCAATTGAAGACTATTAAACTCGAGTTTAATAGTCTTCAATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1923s21c1
Sequence:CCGGCAGTTCCTAGGACGGTATAAACTCGAGTTTATACCGTCCTAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1049s21c1
Sequence:CCGGCGCCAACACGTACCTCTTTATCTCGAGATAAAGAGGTACGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1976s21c1
Sequence:CCGGCGATGGACTGAACAATTTATTCTCGAGAATAAATTGTTCAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019737.1-1192s21c1
Sequence:CCGGGTGACTATCTTGTTCAAACAACTCGAGTTGTTTGAACAAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-2567s21c1
Sequence:CCGGAGGTTAAGCCTTGTGTCAAATCTCGAGATTTGACACAAGGCTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1049s1c1
Sequence:CCGGCGCCAACACGTACCTCTTTATCTCGAGATAAAGAGGTACGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1976s1c1
Sequence:CCGGCGATGGACTGAACAATTTATTCTCGAGAATAAATTGTTCAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1192s1c1
Sequence:CCGGGTGACTATCTTGTTCAAACAACTCGAGTTGTTTGAACAAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019737.1-1549s1c1
Sequence:CCGGCGATGCTCTTTAATGTGGGTTCTCGAGAACCCACATTAAAGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-3486s1c1
Sequence:CCGGGCCCAAATAGTGTTCTTACTTCTCGAGAAGTAAGAACACTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019737
VALIDATED
B4GALT6 MISSION shRNA Lentiviral Transduction Particles
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-2065s21c1
Sequence:CCGGCTCCAATTGAAGACTATTAAACTCGAGTTTAATAGTCTTCAATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1923s21c1
Sequence:CCGGCAGTTCCTAGGACGGTATAAACTCGAGTTTATACCGTCCTAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1049s21c1
Sequence:CCGGCGCCAACACGTACCTCTTTATCTCGAGATAAAGAGGTACGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-1976s21c1
Sequence:CCGGCGATGGACTGAACAATTTATTCTCGAGAATAAATTGTTCAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019737.1-1192s21c1
Sequence:CCGGGTGACTATCTTGTTCAAACAACTCGAGTTGTTTGAACAAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019737.1-2567s21c1
Sequence:CCGGAGGTTAAGCCTTGTGTCAAATCTCGAGATTTGACACAAGGCTTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1049s1c1
Sequence:CCGGCGCCAACACGTACCTCTTTATCTCGAGATAAAGAGGTACGTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1976s1c1
Sequence:CCGGCGATGGACTGAACAATTTATTCTCGAGAATAAATTGTTCAGTCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-1192s1c1
Sequence:CCGGGTGACTATCTTGTTCAAACAACTCGAGTTGTTTGAACAAGATAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019737.1-1549s1c1
Sequence:CCGGCGATGCTCTTTAATGTGGGTTCTCGAGAACCCACATTAAAGAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019737.1-3486s1c1
Sequence:CCGGGCCCAAATAGTGTTCTTACTTCTCGAGAAGTAAGAACACTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks