EMAIL THIS PAGE TO A FRIEND

B4GALT7

xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7

56 Gene Product Result for
Synonyms: EDSP1 XGALT1 XGPT1
UniProtKB ID: Q9UBV7, B3KN39, Q9UHN2
Gene ID:
Human(11285) Summary: This gene is a member of the beta-1,4-galactosyltransferase (beta4GalT) family. Family members encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose. Each beta4GalT member has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus which then remains uncleaved to function as a transmembrane anchor. The enzyme encoded by this gene attaches the first galactose in the common carbohydrate-protein linkage (GlcA-beta1,3-Gal-beta1,3-Gal-beta1,4-Xyl-beta1-O-Ser) found in proteoglycans. This enzyme differs from other beta4GalTs because it lacks the conserved Cys residues found in beta4GalT1-beta4GalT6 and it is located in cis-Golgi instead of trans-Golgi. Mutations in this gene have been associated with the progeroid form of Ehlers-Danlos syndrome. [provided by RefSeq, Oct 2009]
Mouse(218271) xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I)
Rat(364675) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Zebrafish(445022) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I)
cow(507559) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I)
domestic cat(101099172) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
dog(481445) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
chicken(416359) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I)
naked mole-rat(101713013) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
domestic guinea pig(100729826) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
sheep(100316848) xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007255 Rosetta Predictions human pricing
NM_001031661 Rosetta Predictions rat pricing
NM_146045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139842 predicted 1131
2 SASI_Hs01_00139843 predicted 718
3 SASI_Hs01_00139844 predicted 1038
4 SASI_Hs02_00343279 predicted 1033
5 SASI_Hs01_00139845 predicted 1036
6 SASI_Hs01_00139846 predicted 492
7 SASI_Hs01_00139847 predicted 724
8 SASI_Hs01_00139848 predicted 667
9 SASI_Hs01_00139849 predicted 462
10 SASI_Hs01_00139850 predicted 395
11 SASI_Hs01_00139851 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112549 predicted 439
2 SASI_Rn01_00112550 predicted 844
3 SASI_Rn01_00112551 predicted 899
4 SASI_Rn01_00112552 predicted 635
5 SASI_Rn01_00112553 predicted 803
6 SASI_Rn01_00112554 predicted 339
7 SASI_Rn02_00203607 predicted 651
8 SASI_Rn01_00112555 predicted 1119
9 SASI_Rn01_00112556 predicted 679
10 SASI_Rn01_00112557 predicted 1165
11 SASI_Rn01_00112558 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038842 predicted 631
2 SASI_Mm01_00038843 predicted 320
3 SASI_Mm01_00038844 predicted 888
4 SASI_Mm01_00038846 predicted 634
5 SASI_Mm01_00038847 predicted 790
6 SASI_Mm01_00038848 predicted 437
7 SASI_Mm01_00038849 predicted 667
8 SASI_Mm01_00038850 predicted 908
9 SASI_Mm01_00038851 predicted 387
10 SASI_Mm02_00341655 predicted 710
11 SASI_Mm01_00038845 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007255
B4GALT7 MISSION shRNA Bacterial Glycerol Stock
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-899s1c1
Sequence:CCGGCTGAACACTGTGAAGTACCATCTCGAGATGGTACTTCACAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-775s1c1
Sequence:CCGGCTCGGGAATCACAACTGGGTACTCGAGTACCCAGTTGTGATTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-545s1c1
Sequence:CCGGCTCAACGAGGAGCTGGACTATCTCGAGATAGTCCAGCTCCTCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-961s1c1
Sequence:CCGGCACTGTCCTCAACATCATGTTCTCGAGAACATGATGTTGAGGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-610s1c1
Sequence:CCGGCCACCCTCTCTACCACTACAACTCGAGTTGTAGTGGTAGAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007255.2-470s21c1
Sequence:CCGGACCACATCTACGTGCTCAACCCTCGAGGGTTGAGCACGTAGATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007255.2-1188s21c1
Sequence:CCGGAGACAGCAAGCTACGCAATTGCTCGAGCAATTGCGTAGCTTGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007255.2-550s21c1
Sequence:CCGGAGCAACAGCACGGACTACATTCTCGAGAATGTAGTCCGTGCTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007255
B4GALT7 MISSION shRNA shRNA Plasmid DNA
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-899s1c1
Sequence:CCGGCTGAACACTGTGAAGTACCATCTCGAGATGGTACTTCACAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-775s1c1
Sequence:CCGGCTCGGGAATCACAACTGGGTACTCGAGTACCCAGTTGTGATTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-545s1c1
Sequence:CCGGCTCAACGAGGAGCTGGACTATCTCGAGATAGTCCAGCTCCTCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-961s1c1
Sequence:CCGGCACTGTCCTCAACATCATGTTCTCGAGAACATGATGTTGAGGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-610s1c1
Sequence:CCGGCCACCCTCTCTACCACTACAACTCGAGTTGTAGTGGTAGAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007255.2-470s21c1
Sequence:CCGGACCACATCTACGTGCTCAACCCTCGAGGGTTGAGCACGTAGATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007255.2-1188s21c1
Sequence:CCGGAGACAGCAAGCTACGCAATTGCTCGAGCAATTGCGTAGCTTGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007255.2-550s21c1
Sequence:CCGGAGCAACAGCACGGACTACATTCTCGAGAATGTAGTCCGTGCTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007255
B4GALT7 MISSION shRNA Lentiviral Transduction Particles
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-899s1c1
Sequence:CCGGCTGAACACTGTGAAGTACCATCTCGAGATGGTACTTCACAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-775s1c1
Sequence:CCGGCTCGGGAATCACAACTGGGTACTCGAGTACCCAGTTGTGATTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-545s1c1
Sequence:CCGGCTCAACGAGGAGCTGGACTATCTCGAGATAGTCCAGCTCCTCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-961s1c1
Sequence:CCGGCACTGTCCTCAACATCATGTTCTCGAGAACATGATGTTGAGGACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007255.1-610s1c1
Sequence:CCGGCCACCCTCTCTACCACTACAACTCGAGTTGTAGTGGTAGAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007255.2-470s21c1
Sequence:CCGGACCACATCTACGTGCTCAACCCTCGAGGGTTGAGCACGTAGATGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007255.2-1188s21c1
Sequence:CCGGAGACAGCAAGCTACGCAATTGCTCGAGCAATTGCGTAGCTTGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007255.2-550s21c1
Sequence:CCGGAGCAACAGCACGGACTACATTCTCGAGAATGTAGTCCGTGCTGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146045
VALIDATED
B4GALT7 MISSION shRNA Bacterial Glycerol Stock
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-1458s1c1
Sequence:CCGGGCGGCTGATATAGCTGTAATTCTCGAGAATTACAGCTATATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-407s1c1
Sequence:CCGGGCACCACATCTATGTGCTCAACTCGAGTTGAGCACATAGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-966s1c1
Sequence:CCGGGTCATGCTGGACTGCGATAAACTCGAGTTTATCGCAGTCCAGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-432s1c1
Sequence:CCGGGTGGACCATTTCAGGTTCAATCTCGAGATTGAACCTGAAATGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-182s1c1
Sequence:CCGGGCTCAGCTGTTCTGGAGATATCTCGAGATATCTCCAGAACAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-966s21c1
Sequence:CCGGGTCATGCTGGACTGCGATAAACTCGAGTTTATCGCAGTCCAGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-1458s21c1
Sequence:CCGGGCGGCTGATATAGCTGTAATTCTCGAGAATTACAGCTATATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-182s21c1
Sequence:CCGGGCTCAGCTGTTCTGGAGATATCTCGAGATATCTCCAGAACAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-1004s21c1
Sequence:CCGGCATATTTGGCTGACAGCTAAACTCGAGTTTAGCTGTCAGCCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-538s21c1
Sequence:CCGGTCAATGAGGAGCTGGACTATGCTCGAGCATAGTCCAGCTCCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146045
VALIDATED
B4GALT7 MISSION shRNA shRNA Plasmid DNA
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-1458s1c1
Sequence:CCGGGCGGCTGATATAGCTGTAATTCTCGAGAATTACAGCTATATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-407s1c1
Sequence:CCGGGCACCACATCTATGTGCTCAACTCGAGTTGAGCACATAGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-966s1c1
Sequence:CCGGGTCATGCTGGACTGCGATAAACTCGAGTTTATCGCAGTCCAGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-432s1c1
Sequence:CCGGGTGGACCATTTCAGGTTCAATCTCGAGATTGAACCTGAAATGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-182s1c1
Sequence:CCGGGCTCAGCTGTTCTGGAGATATCTCGAGATATCTCCAGAACAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-966s21c1
Sequence:CCGGGTCATGCTGGACTGCGATAAACTCGAGTTTATCGCAGTCCAGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-1458s21c1
Sequence:CCGGGCGGCTGATATAGCTGTAATTCTCGAGAATTACAGCTATATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-182s21c1
Sequence:CCGGGCTCAGCTGTTCTGGAGATATCTCGAGATATCTCCAGAACAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-1004s21c1
Sequence:CCGGCATATTTGGCTGACAGCTAAACTCGAGTTTAGCTGTCAGCCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-538s21c1
Sequence:CCGGTCAATGAGGAGCTGGACTATGCTCGAGCATAGTCCAGCTCCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146045
VALIDATED
B4GALT7 MISSION shRNA Lentiviral Transduction Particles
xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-1458s1c1
Sequence:CCGGGCGGCTGATATAGCTGTAATTCTCGAGAATTACAGCTATATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-407s1c1
Sequence:CCGGGCACCACATCTATGTGCTCAACTCGAGTTGAGCACATAGATGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-966s1c1
Sequence:CCGGGTCATGCTGGACTGCGATAAACTCGAGTTTATCGCAGTCCAGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-432s1c1
Sequence:CCGGGTGGACCATTTCAGGTTCAATCTCGAGATTGAACCTGAAATGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146045.1-182s1c1
Sequence:CCGGGCTCAGCTGTTCTGGAGATATCTCGAGATATCTCCAGAACAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-966s21c1
Sequence:CCGGGTCATGCTGGACTGCGATAAACTCGAGTTTATCGCAGTCCAGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-1458s21c1
Sequence:CCGGGCGGCTGATATAGCTGTAATTCTCGAGAATTACAGCTATATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-182s21c1
Sequence:CCGGGCTCAGCTGTTCTGGAGATATCTCGAGATATCTCCAGAACAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-1004s21c1
Sequence:CCGGCATATTTGGCTGACAGCTAAACTCGAGTTTAGCTGTCAGCCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146045.1-538s21c1
Sequence:CCGGTCAATGAGGAGCTGGACTATGCTCGAGCATAGTCCAGCTCCTCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks