EMAIL THIS PAGE TO A FRIEND

B9D1

B9 protein domain 1

45 Gene Product Result for
Synonyms: B9 EPPB9 MKS9 MKSR1
UniProtKB ID: Q9UPM9, Q9BU22
Gene ID:
Human(27077) Summary: This gene encodes a B9 domain-containing protein, one of several that are involved in ciliogenesis. Alterations in expression of this gene have been found in a family with Meckel syndrome. Meckel syndrome has been associated with at least six different genes. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Three alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(27078) B9 protein domain 1
Rat(287383) B9 protein domain 1
naked mole-rat(101726021) B9 protein domain 1
domestic guinea pig(100728113) B9 protein domain 1
sheep(101110346) B9 protein domain 1
Zebrafish(554150) B9 protein domain 1
dog(479519) B9 protein domain 1
cow(505335) B9 protein domain 1
domestic cat(101097602) B9 protein domain 1
chicken(416525) B9 protein domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015681 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015681 Rosetta Predictions human pricing
NM_001105786 Rosetta Predictions rat pricing
NM_013717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348332 predicted 704
2 SASI_Hs01_00148955 predicted 409
3 SASI_Hs01_00148956 predicted 538
4 SASI_Hs01_00148957 predicted 221
5 SASI_Hs01_00148958 predicted 427
6 SASI_Hs01_00148959 predicted 623
7 SASI_Hs01_00148961 predicted 228
8 SASI_Hs01_00148962 predicted 426
9 SASI_Hs01_00148963 predicted 539
10 SASI_Hs01_00148964 predicted 627
11 SASI_Hs01_00148960 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212516 predicted 261
2 SASI_Rn02_00212517 predicted 217
3 SASI_Rn02_00212518 predicted 411
4 SASI_Rn02_00212519 predicted 301
5 SASI_Rn02_00212520 predicted 196
6 SASI_Rn02_00212521 predicted 526
7 SASI_Rn02_00212522 predicted 191
8 SASI_Rn02_00212523 predicted 422
9 SASI_Rn02_00212524 predicted 212
10 SASI_Rn02_00212525 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188949 predicted 308
2 SASI_Mm01_00188950 predicted 200
3 SASI_Mm01_00188951 predicted 293
4 SASI_Mm01_00188952 predicted 393
5 SASI_Mm01_00188953 predicted 297
6 SASI_Mm01_00188954 predicted 238
7 SASI_Mm01_00188955 predicted 267
8 SASI_Mm01_00188956 predicted 510
9 SASI_Mm01_00188957 predicted 404
10 SASI_Mm02_00322632 predicted 409
11 SASI_Mm01_00188958 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013717
VALIDATED
B9D1 MISSION shRNA Bacterial Glycerol Stock
B9 protein domain 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-396s1c1
Sequence:CCGGCCATGTTTGTGCCAGAGTCTACTCGAGTAGACTCTGGCACAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-283s1c1
Sequence:CCGGGCCACAGATTGTACTCAGTGTCTCGAGACACTGAGTACAATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-184s1c1
Sequence:CCGGGATCTCACAGATAGCATCTAACTCGAGTTAGATGCTATCTGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-311s1c1
Sequence:CCGGCCGGATGTGTTTGGGAATGATCTCGAGATCATTCCCAAACACATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-191s1c1
Sequence:CCGGCAGATAGCATCTAAGAGCCAACTCGAGTTGGCTCTTAGATGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-407s1c1
Sequence:CCGGCCAGAGTCTACATCTACACTACTCGAGTAGTGTAGATGTAGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-197s1c1
Sequence:CCGGGCATCTAAGAGCCAAGATGTACTCGAGTACATCTTGGCTCTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013717.1-544s1c1
Sequence:CCGGCCTCTTCAATGTGGTGACCAACTCGAGTTGGTCACCACATTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013717
VALIDATED
B9D1 MISSION shRNA shRNA Plasmid DNA
B9 protein domain 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-396s1c1
Sequence:CCGGCCATGTTTGTGCCAGAGTCTACTCGAGTAGACTCTGGCACAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-283s1c1
Sequence:CCGGGCCACAGATTGTACTCAGTGTCTCGAGACACTGAGTACAATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-184s1c1
Sequence:CCGGGATCTCACAGATAGCATCTAACTCGAGTTAGATGCTATCTGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-311s1c1
Sequence:CCGGCCGGATGTGTTTGGGAATGATCTCGAGATCATTCCCAAACACATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-191s1c1
Sequence:CCGGCAGATAGCATCTAAGAGCCAACTCGAGTTGGCTCTTAGATGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-407s1c1
Sequence:CCGGCCAGAGTCTACATCTACACTACTCGAGTAGTGTAGATGTAGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-197s1c1
Sequence:CCGGGCATCTAAGAGCCAAGATGTACTCGAGTACATCTTGGCTCTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013717.1-544s1c1
Sequence:CCGGCCTCTTCAATGTGGTGACCAACTCGAGTTGGTCACCACATTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013717
VALIDATED
B9D1 MISSION shRNA Lentiviral Transduction Particles
B9 protein domain 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-396s1c1
Sequence:CCGGCCATGTTTGTGCCAGAGTCTACTCGAGTAGACTCTGGCACAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-283s1c1
Sequence:CCGGGCCACAGATTGTACTCAGTGTCTCGAGACACTGAGTACAATCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-184s1c1
Sequence:CCGGGATCTCACAGATAGCATCTAACTCGAGTTAGATGCTATCTGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-311s1c1
Sequence:CCGGCCGGATGTGTTTGGGAATGATCTCGAGATCATTCCCAAACACATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-191s1c1
Sequence:CCGGCAGATAGCATCTAAGAGCCAACTCGAGTTGGCTCTTAGATGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013717.1-407s1c1
Sequence:CCGGCCAGAGTCTACATCTACACTACTCGAGTAGTGTAGATGTAGACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013717.1-197s1c1
Sequence:CCGGGCATCTAAGAGCCAAGATGTACTCGAGTACATCTTGGCTCTTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013717.1-544s1c1
Sequence:CCGGCCTCTTCAATGTGGTGACCAACTCGAGTTGGTCACCACATTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015681
VALIDATED
B9D1 MISSION shRNA Bacterial Glycerol Stock
B9 protein domain 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015681.2-517s1c1
Sequence:CCGGCCATGTTTGTCCCAGAATCTACTCGAGTAGATTCTGGGACAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015681.2-551s1c1
Sequence:CCGGGAAGTTTACAAGCTGGTTCATCTCGAGATGAACCAGCTTGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-527s1c1
Sequence:CCGGCCCAGAATCTACGTCTAAACTCTCGAGAGTTTAGACGTAGATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-548s1c1
Sequence:CCGGGCAGAAGTTTACAAGCTGGTTCTCGAGAACCAGCTTGTAAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-240s1c1
Sequence:CCGGCTCTACTGCAAGTACTGCTTTCTCGAGAAAGCAGTACTTGCAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-415s21c1
Sequence:CCGGAGATCGTGCTCAGCGTGTATGCTCGAGCATACACGCTGAGCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015681.3-246s21c1
Sequence:CCGGCTCTACTGCAAGTACTGCTTTCTCGAGAAAGCAGTACTTGCAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015681.3-554s21c1
Sequence:CCGGGCAGAAGTTTACAAGCTGGTTCTCGAGAACCAGCTTGTAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-533s21c1
Sequence:CCGGCCCAGAATCTACGTCTAAACTCTCGAGAGTTTAGACGTAGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-369s21c1
Sequence:CCGGCCCATTGATGTCACCTTTAAACTCGAGTTTAAAGGTGACATCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015681
VALIDATED
B9D1 MISSION shRNA shRNA Plasmid DNA
B9 protein domain 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015681.2-517s1c1
Sequence:CCGGCCATGTTTGTCCCAGAATCTACTCGAGTAGATTCTGGGACAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015681.2-551s1c1
Sequence:CCGGGAAGTTTACAAGCTGGTTCATCTCGAGATGAACCAGCTTGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-527s1c1
Sequence:CCGGCCCAGAATCTACGTCTAAACTCTCGAGAGTTTAGACGTAGATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-548s1c1
Sequence:CCGGGCAGAAGTTTACAAGCTGGTTCTCGAGAACCAGCTTGTAAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-240s1c1
Sequence:CCGGCTCTACTGCAAGTACTGCTTTCTCGAGAAAGCAGTACTTGCAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-415s21c1
Sequence:CCGGAGATCGTGCTCAGCGTGTATGCTCGAGCATACACGCTGAGCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015681.3-246s21c1
Sequence:CCGGCTCTACTGCAAGTACTGCTTTCTCGAGAAAGCAGTACTTGCAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015681.3-554s21c1
Sequence:CCGGGCAGAAGTTTACAAGCTGGTTCTCGAGAACCAGCTTGTAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-533s21c1
Sequence:CCGGCCCAGAATCTACGTCTAAACTCTCGAGAGTTTAGACGTAGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-369s21c1
Sequence:CCGGCCCATTGATGTCACCTTTAAACTCGAGTTTAAAGGTGACATCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015681
VALIDATED
B9D1 MISSION shRNA Lentiviral Transduction Particles
B9 protein domain 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015681.2-517s1c1
Sequence:CCGGCCATGTTTGTCCCAGAATCTACTCGAGTAGATTCTGGGACAAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015681.2-551s1c1
Sequence:CCGGGAAGTTTACAAGCTGGTTCATCTCGAGATGAACCAGCTTGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-527s1c1
Sequence:CCGGCCCAGAATCTACGTCTAAACTCTCGAGAGTTTAGACGTAGATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-548s1c1
Sequence:CCGGGCAGAAGTTTACAAGCTGGTTCTCGAGAACCAGCTTGTAAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015681.2-240s1c1
Sequence:CCGGCTCTACTGCAAGTACTGCTTTCTCGAGAAAGCAGTACTTGCAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-415s21c1
Sequence:CCGGAGATCGTGCTCAGCGTGTATGCTCGAGCATACACGCTGAGCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015681.3-246s21c1
Sequence:CCGGCTCTACTGCAAGTACTGCTTTCTCGAGAAAGCAGTACTTGCAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015681.3-554s21c1
Sequence:CCGGGCAGAAGTTTACAAGCTGGTTCTCGAGAACCAGCTTGTAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-533s21c1
Sequence:CCGGCCCAGAATCTACGTCTAAACTCTCGAGAGTTTAGACGTAGATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015681.3-369s21c1
Sequence:CCGGCCCATTGATGTCACCTTTAAACTCGAGTTTAAAGGTGACATCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks