EMAIL THIS PAGE TO A FRIEND

B9D2

B9 protein domain 2

48 Gene Product Result for
Synonyms: ICIS-1 MKS10 MKSR2
UniProtKB ID: Q9BPU9
Gene ID:
Human(80776) Summary: This gene encodes a B9 domain protein, which are exclusively found in ciliated organisms. The gene is upregulated during mucociliary differentiation, and the encoded protein localizes to basal bodies and cilia. Disrupting expression of this gene results in ciliogenesis defects. [provided by RefSeq, Oct 2009]
Mouse(232987) B9 protein domain 2
Rat(308443) B9 protein domain 2
Zebrafish(436667) B9 protein domain 2
domestic cat(101087954) B9 protein domain 2
cow(616609) B9 protein domain 2
dog(476451) B9 protein domain 2
sheep(101102082) B9 protein domain 2
domestic guinea pig(100730785) B9 protein domain 2
naked mole-rat(101704578) B9 protein domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052861 MISSION® esiRNA esiRNA human B9D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030578 Rosetta Predictions human pricing
NM_001107494 Rosetta Predictions rat pricing
NM_172148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017174 predicted 292
2 SASI_Hs01_00017175 predicted 445
3 SASI_Hs01_00017177 predicted 208
4 SASI_Hs01_00017178 predicted 441
5 SASI_Hs01_00017179 predicted 265
6 SASI_Hs01_00017180 predicted 220
7 SASI_Hs02_00358147 predicted 524
8 SASI_Hs01_00017181 predicted 228
9 SASI_Hs02_00358148 predicted 358
10 SASI_Hs01_00017182 predicted 217
11 SASI_Hs01_00017176 predicted 404
12 SASI_Hs01_00017183 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229385 predicted 442
2 SASI_Rn02_00229386 predicted 248
3 SASI_Rn02_00229387 predicted 445
4 SASI_Rn02_00229388 predicted 245
5 SASI_Rn02_00229389 predicted 758
6 SASI_Rn02_00229390 predicted 701
7 SASI_Rn02_00229391 predicted 804
8 SASI_Rn02_00229392 predicted 775
9 SASI_Rn02_00229393 predicted 734
10 SASI_Rn02_00229394 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088186 predicted 757
2 SASI_Mm01_00088187 predicted 786
3 SASI_Mm01_00088188 predicted 243
4 SASI_Mm01_00088189 predicted 722
5 SASI_Mm01_00088190 predicted 749
6 SASI_Mm01_00088191 predicted 742
7 SASI_Mm01_00088192 predicted 236
8 SASI_Mm01_00088193 predicted 617
9 SASI_Mm01_00088194 predicted 410
10 SASI_Mm01_00088195 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030578
B9D2 MISSION shRNA Bacterial Glycerol Stock
B9 protein domain 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-447s21c1
Sequence:CCGGCAGCTTGCAGGCTATGGATTTCTCGAGAAATCCATAGCCTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030578.2-830s21c1
Sequence:CCGGGCACCGCTTCTGTCCTTTCTACTCGAGTAGAAAGGACAGAAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-539s21c1
Sequence:CCGGAGAACAGTTGGCACGGGCTTTCTCGAGAAAGCCCGTGCCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-217s21c1
Sequence:CCGGCCAGCGGTTTCTCGGAAAGTACTCGAGTACTTTCCGAGAAACCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-371s21c1
Sequence:CCGGCTTCGCCACCAAAGGTCTTCACTCGAGTGAAGACCTTTGGTGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030578
B9D2 MISSION shRNA shRNA Plasmid DNA
B9 protein domain 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-447s21c1
Sequence:CCGGCAGCTTGCAGGCTATGGATTTCTCGAGAAATCCATAGCCTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030578.2-830s21c1
Sequence:CCGGGCACCGCTTCTGTCCTTTCTACTCGAGTAGAAAGGACAGAAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-539s21c1
Sequence:CCGGAGAACAGTTGGCACGGGCTTTCTCGAGAAAGCCCGTGCCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-217s21c1
Sequence:CCGGCCAGCGGTTTCTCGGAAAGTACTCGAGTACTTTCCGAGAAACCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-371s21c1
Sequence:CCGGCTTCGCCACCAAAGGTCTTCACTCGAGTGAAGACCTTTGGTGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030578
B9D2 MISSION shRNA Lentiviral Transduction Particles
B9 protein domain 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-447s21c1
Sequence:CCGGCAGCTTGCAGGCTATGGATTTCTCGAGAAATCCATAGCCTGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030578.2-830s21c1
Sequence:CCGGGCACCGCTTCTGTCCTTTCTACTCGAGTAGAAAGGACAGAAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-539s21c1
Sequence:CCGGAGAACAGTTGGCACGGGCTTTCTCGAGAAAGCCCGTGCCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-217s21c1
Sequence:CCGGCCAGCGGTTTCTCGGAAAGTACTCGAGTACTTTCCGAGAAACCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030578.2-371s21c1
Sequence:CCGGCTTCGCCACCAAAGGTCTTCACTCGAGTGAAGACCTTTGGTGGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172148
VALIDATED
B9D2 MISSION shRNA Bacterial Glycerol Stock
B9 protein domain 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172148.1-497s21c1
Sequence:CCGGCAGCTTGCTGGCTATGGCTTTCTCGAGAAAGCCATAGCCAGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-633s21c1
Sequence:CCGGTGCACGCAGATACCATCTACACTCGAGTGTAGATGGTATCTGCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-735s21c1
Sequence:CCGGATCGCTATGGAGTGGAGTGTTCTCGAGAACACTCCACTCCATAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-758s21c1
Sequence:CCGGGGGACTTCATTGCTACTAATCCTCGAGGATTAGTAGCAATGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-413s21c1
Sequence:CCGGGACCTGCACTTCGCTACTAAACTCGAGTTTAGTAGCGAAGTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172148.1-418s1c1
Sequence:CCGGGCACTTCGCTACTAAAGGTCTCTCGAGAGACCTTTAGTAGCGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172148.1-780s1c1
Sequence:CCGGCCATCATCCACTGAGCACATACTCGAGTATGTGCTCAGTGGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172148.1-413s1c1
Sequence:CCGGGACCTGCACTTCGCTACTAAACTCGAGTTTAGTAGCGAAGTGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172148
VALIDATED
B9D2 MISSION shRNA shRNA Plasmid DNA
B9 protein domain 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172148.1-497s21c1
Sequence:CCGGCAGCTTGCTGGCTATGGCTTTCTCGAGAAAGCCATAGCCAGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-633s21c1
Sequence:CCGGTGCACGCAGATACCATCTACACTCGAGTGTAGATGGTATCTGCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-735s21c1
Sequence:CCGGATCGCTATGGAGTGGAGTGTTCTCGAGAACACTCCACTCCATAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-758s21c1
Sequence:CCGGGGGACTTCATTGCTACTAATCCTCGAGGATTAGTAGCAATGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-413s21c1
Sequence:CCGGGACCTGCACTTCGCTACTAAACTCGAGTTTAGTAGCGAAGTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172148.1-418s1c1
Sequence:CCGGGCACTTCGCTACTAAAGGTCTCTCGAGAGACCTTTAGTAGCGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172148.1-780s1c1
Sequence:CCGGCCATCATCCACTGAGCACATACTCGAGTATGTGCTCAGTGGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172148.1-413s1c1
Sequence:CCGGGACCTGCACTTCGCTACTAAACTCGAGTTTAGTAGCGAAGTGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172148
VALIDATED
B9D2 MISSION shRNA Lentiviral Transduction Particles
B9 protein domain 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172148.1-497s21c1
Sequence:CCGGCAGCTTGCTGGCTATGGCTTTCTCGAGAAAGCCATAGCCAGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-633s21c1
Sequence:CCGGTGCACGCAGATACCATCTACACTCGAGTGTAGATGGTATCTGCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-735s21c1
Sequence:CCGGATCGCTATGGAGTGGAGTGTTCTCGAGAACACTCCACTCCATAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-758s21c1
Sequence:CCGGGGGACTTCATTGCTACTAATCCTCGAGGATTAGTAGCAATGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172148.1-413s21c1
Sequence:CCGGGACCTGCACTTCGCTACTAAACTCGAGTTTAGTAGCGAAGTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172148.1-418s1c1
Sequence:CCGGGCACTTCGCTACTAAAGGTCTCTCGAGAGACCTTTAGTAGCGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172148.1-780s1c1
Sequence:CCGGCCATCATCCACTGAGCACATACTCGAGTATGTGCTCAGTGGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172148.1-413s1c1
Sequence:CCGGGACCTGCACTTCGCTACTAAACTCGAGTTTAGTAGCGAAGTGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks