EMAIL THIS PAGE TO A FRIEND

BAALC

brain and acute leukemia, cytoplasmic

192 Gene Product Result for
UniProtKB ID: Q8WXS3, Q8WTP6, Q8WXS0, Q8WXS1, Q8WXS2, Q9HA93
Gene ID:
Human(79870) Summary: This gene was identified by gene expression studies in patients with acute myeloid leukemia (AML). The gene is conserved among mammals and is not found in lower organisms. Tissues that express this gene develop from the neuroectoderm. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene; however, some of the transcript variants are found only in AML cell lines. [provided by RefSeq, Jul 2008]
Mouse(118452) brain and acute leukemia, cytoplasmic
Rat(140720) brain and acute leukemia, cytoplasmic
naked mole-rat(101722551) brain and acute leukemia, cytoplasmic
domestic guinea pig(100720028) brain and acute leukemia, cytoplasmic
sheep(101103328) brain and acute leukemia, cytoplasmic
Zebrafish(368908) brain and acute leukemia, cytoplasmic
dog(612780) brain and acute leukemia, cytoplasmic
cow(614130) brain and acute leukemia, cytoplasmic
domestic cat(101084259) brain and acute leukemia, cytoplasmic
chicken(420261) brain and acute leukemia, cytoplasmic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024812 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098091 MISSION® esiRNA esiRNA human BAALC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024372 Rosetta Predictions human pricing
NM_024812 Rosetta Predictions human pricing
NM_144762 Rosetta Predictions rat pricing
NM_080640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237266 predicted 833
2 SASI_Hs01_00237267 predicted 767
3 SASI_Hs01_00237270 predicted 773
4 SASI_Hs01_00237271 predicted 742
5 SASI_Hs01_00237272 predicted 582
6 SASI_Hs01_00237273 predicted 653
7 SASI_Hs02_00307138 predicted 824
8 SASI_Hs01_00237274 predicted 861
9 SASI_Hs02_00307139 predicted 609
10 SASI_Hs02_00307140 predicted 856
11 SASI_Hs01_00237268 predicted 825
12 SASI_Hs01_00237269 predicted 716
13 SASI_Hs01_00237275 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036806 predicted 1046
2 SASI_Hs01_00036807 predicted 840
3 SASI_Hs02_00357361 predicted 803
4 SASI_Hs01_00036809 predicted 941
5 SASI_Hs01_00036810 predicted 1114
6 SASI_Hs01_00036811 predicted 753
7 SASI_Hs01_00036812 predicted 817
8 SASI_Hs01_00036813 predicted 1135
9 SASI_Hs02_00357362 predicted 1045
10 SASI_Hs01_00036814 predicted 1137
11 SASI_Hs01_00036808 predicted 881
12 SASI_Hs01_00036815 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044177 predicted 540
2 SASI_Rn01_00044179 predicted 358
3 SASI_Rn01_00044180 predicted 587
4 SASI_Rn02_00268653 predicted 606
5 SASI_Rn01_00044178 predicted 629
6 SASI_Rn01_00044182 predicted 525
7 SASI_Rn01_00044183 predicted 996
8 SASI_Rn01_00044184 predicted 1033
9 SASI_Rn01_00044185 predicted 970
10 SASI_Rn02_00268654 predicted 660
11 SASI_Rn01_00044181 predicted 507
12 SASI_Rn01_00044186 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183776 predicted 489
2 SASI_Mm01_00183777 predicted 790
3 SASI_Mm01_00183778 predicted 749
4 SASI_Mm01_00183779 predicted 487
5 SASI_Mm01_00183780 predicted 618
6 SASI_Mm02_00338197 predicted 528
7 SASI_Mm01_00183781 predicted 658
8 SASI_Mm01_00183782 predicted 255
9 SASI_Mm01_00183783 predicted 466
10 SASI_Mm01_00183785 predicted 373
11 SASI_Mm01_00183784 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080640
BAALC MISSION shRNA Bacterial Glycerol Stock
brain and acute leukemia, cytoplasmic
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-411s1c1
Sequence:CCGGGAAGTGGCTATTAATGTTACACTCGAGTGTAACATTAATAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-467s1c1
Sequence:CCGGCACCAAGAACTGCATCAATTACTCGAGTAATTGATGCAGTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-401s1c1
Sequence:CCGGGTCTGCAAGAGAAGTGGCTATCTCGAGATAGCCACTTCTCTTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-467s21c1
Sequence:CCGGCACCAAGAACTGCATCAATTACTCGAGTAATTGATGCAGTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-441s21c1
Sequence:CCGGCGGCAGATGGACAGAAGTAAACTCGAGTTTACTTCTGTCCATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080640.4-623s1c1
Sequence:CCGGGGTTTCCTGTTTATCACATATCTCGAGATATGTGATAAACAGGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-291s21c1
Sequence:CCGGATGAACTGTGGGACCCAATGTCTCGAGACATTGGGTCCCACAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-405s21c1
Sequence:CCGGGCAAGAGAAGTGGCTATTAATCTCGAGATTAATAGCCACTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080640.4-1564s21c1
Sequence:CCGGTAACATGCTTGGGCTTATTAACTCGAGTTAATAAGCCCAAGCATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080640
BAALC MISSION shRNA shRNA Plasmid DNA
brain and acute leukemia, cytoplasmic
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-411s1c1
Sequence:CCGGGAAGTGGCTATTAATGTTACACTCGAGTGTAACATTAATAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-467s1c1
Sequence:CCGGCACCAAGAACTGCATCAATTACTCGAGTAATTGATGCAGTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-401s1c1
Sequence:CCGGGTCTGCAAGAGAAGTGGCTATCTCGAGATAGCCACTTCTCTTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-467s21c1
Sequence:CCGGCACCAAGAACTGCATCAATTACTCGAGTAATTGATGCAGTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-441s21c1
Sequence:CCGGCGGCAGATGGACAGAAGTAAACTCGAGTTTACTTCTGTCCATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080640.4-623s1c1
Sequence:CCGGGGTTTCCTGTTTATCACATATCTCGAGATATGTGATAAACAGGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-291s21c1
Sequence:CCGGATGAACTGTGGGACCCAATGTCTCGAGACATTGGGTCCCACAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-405s21c1
Sequence:CCGGGCAAGAGAAGTGGCTATTAATCTCGAGATTAATAGCCACTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080640.4-1564s21c1
Sequence:CCGGTAACATGCTTGGGCTTATTAACTCGAGTTAATAAGCCCAAGCATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080640
BAALC MISSION shRNA Lentiviral Transduction Particles
brain and acute leukemia, cytoplasmic
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-411s1c1
Sequence:CCGGGAAGTGGCTATTAATGTTACACTCGAGTGTAACATTAATAGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-467s1c1
Sequence:CCGGCACCAAGAACTGCATCAATTACTCGAGTAATTGATGCAGTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080640.3-401s1c1
Sequence:CCGGGTCTGCAAGAGAAGTGGCTATCTCGAGATAGCCACTTCTCTTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-467s21c1
Sequence:CCGGCACCAAGAACTGCATCAATTACTCGAGTAATTGATGCAGTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-441s21c1
Sequence:CCGGCGGCAGATGGACAGAAGTAAACTCGAGTTTACTTCTGTCCATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080640.4-623s1c1
Sequence:CCGGGGTTTCCTGTTTATCACATATCTCGAGATATGTGATAAACAGGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-291s21c1
Sequence:CCGGATGAACTGTGGGACCCAATGTCTCGAGACATTGGGTCCCACAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080640.4-405s21c1
Sequence:CCGGGCAAGAGAAGTGGCTATTAATCTCGAGATTAATAGCCACTTCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080640.4-1564s21c1
Sequence:CCGGTAACATGCTTGGGCTTATTAACTCGAGTTAATAAGCCCAAGCATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024812
BAALC MISSION shRNA Bacterial Glycerol Stock
brain and acute leukemia, cytoplasmic
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-496s1c1
Sequence:CCGGCTTCAGACCACAGAGGCTAAACTCGAGTTTAGCCTCTGTGGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-472s1c1
Sequence:CCGGCCTCTGACCCAGAAACAGAATCTCGAGATTCTGTTTCTGGGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-574s1c1
Sequence:CCGGCAACAGATGGACAGAAGTCGACTCGAGTCGACTTCTGTCCATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-412s1c1
Sequence:CCGGCCAGAGAAGAAGACGAACTGTCTCGAGACAGTTCGTCTTCTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-518s1c1
Sequence:CCGGGAGATGCTAAGAGAATGCCTGCTCGAGCAGGCATTCTCTTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-547s1c1
Sequence:CCGGGTCACCATTAATGTAACAGATCTCGAGATCTGTTACATTAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024812.2-274s21c1
Sequence:CCGGAGAATCCACCTGGCTCACCTACTCGAGTAGGTGAGCCAGGTGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024812.2-624s21c1
Sequence:CCGGCAAAGAACTGTGTCAACTAGCCTCGAGGCTAGTTGACACAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024812.2-1101s21c1
Sequence:CCGGATCTTACCAGGTTCACTTAAACTCGAGTTTAAGTGAACCTGGTAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024812
BAALC MISSION shRNA shRNA Plasmid DNA
brain and acute leukemia, cytoplasmic
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-496s1c1
Sequence:CCGGCTTCAGACCACAGAGGCTAAACTCGAGTTTAGCCTCTGTGGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-472s1c1
Sequence:CCGGCCTCTGACCCAGAAACAGAATCTCGAGATTCTGTTTCTGGGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-574s1c1
Sequence:CCGGCAACAGATGGACAGAAGTCGACTCGAGTCGACTTCTGTCCATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-412s1c1
Sequence:CCGGCCAGAGAAGAAGACGAACTGTCTCGAGACAGTTCGTCTTCTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-518s1c1
Sequence:CCGGGAGATGCTAAGAGAATGCCTGCTCGAGCAGGCATTCTCTTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-547s1c1
Sequence:CCGGGTCACCATTAATGTAACAGATCTCGAGATCTGTTACATTAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024812.2-274s21c1
Sequence:CCGGAGAATCCACCTGGCTCACCTACTCGAGTAGGTGAGCCAGGTGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024812.2-624s21c1
Sequence:CCGGCAAAGAACTGTGTCAACTAGCCTCGAGGCTAGTTGACACAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024812.2-1101s21c1
Sequence:CCGGATCTTACCAGGTTCACTTAAACTCGAGTTTAAGTGAACCTGGTAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024812
BAALC MISSION shRNA Lentiviral Transduction Particles
brain and acute leukemia, cytoplasmic
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-496s1c1
Sequence:CCGGCTTCAGACCACAGAGGCTAAACTCGAGTTTAGCCTCTGTGGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-472s1c1
Sequence:CCGGCCTCTGACCCAGAAACAGAATCTCGAGATTCTGTTTCTGGGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-574s1c1
Sequence:CCGGCAACAGATGGACAGAAGTCGACTCGAGTCGACTTCTGTCCATCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-412s1c1
Sequence:CCGGCCAGAGAAGAAGACGAACTGTCTCGAGACAGTTCGTCTTCTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-518s1c1
Sequence:CCGGGAGATGCTAAGAGAATGCCTGCTCGAGCAGGCATTCTCTTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024812.1-547s1c1
Sequence:CCGGGTCACCATTAATGTAACAGATCTCGAGATCTGTTACATTAATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024812.2-274s21c1
Sequence:CCGGAGAATCCACCTGGCTCACCTACTCGAGTAGGTGAGCCAGGTGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024812.2-624s21c1
Sequence:CCGGCAAAGAACTGTGTCAACTAGCCTCGAGGCTAGTTGACACAGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024812.2-1101s21c1
Sequence:CCGGATCTTACCAGGTTCACTTAAACTCGAGTTTAAGTGAACCTGGTAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks