EMAIL THIS PAGE TO A FRIEND

BAAT

bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)

185 Gene Product Result for
Synonyms: BACAT BAT
UniProtKB ID: Q14032, Q3B7W9, Q96L31
Gene ID:
Human(570) Summary: The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12012) bile acid-Coenzyme A: amino acid N-acyltransferase
Rat(29725) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
chicken(769879) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
cow(786798) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Horse(100054567) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
domestic cat(101096116) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
dog(481635) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
sheep(101106149) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
naked mole-rat(101716142) bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127610 Rosetta Predictions human pricing
NM_001701 Rosetta Predictions human pricing
NM_017300 Rosetta Predictions rat pricing
NM_007519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329864 predicted 249
2 SASI_Hs02_00329865 predicted 1021
3 SASI_Hs02_00329866 predicted 1116
4 SASI_Hs02_00329867 predicted 477
5 SASI_Hs02_00329868 predicted 1097
6 SASI_Hs02_00329869 predicted 829
7 SASI_Hs02_00329870 predicted 712
8 SASI_Hs02_00329871 predicted 1399
9 SASI_Hs02_00329872 predicted 1191
10 SASI_Hs02_00329873 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019852 predicted 346
2 SASI_Hs01_00019855 predicted 1119
3 SASI_Hs01_00019856 predicted 1214
4 SASI_Hs02_00332370 predicted 579
5 SASI_Hs01_00019858 predicted 1199
6 SASI_Hs01_00019859 predicted 931
7 SASI_Hs01_00019860 predicted 813
8 SASI_Hs01_00019861 predicted 1503
9 SASI_Hs02_00332371 predicted 1290
10 SASI_Hs02_00332372 predicted 900
11 SASI_Hs01_00019853 predicted 392
12 SASI_Hs01_00019854 predicted 470
13 SASI_Hs01_00019857 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062470 predicted 1424
2 SASI_Rn02_00261741 predicted 318
3 SASI_Rn01_00062471 predicted 532
4 SASI_Rn01_00062473 predicted 1192
5 SASI_Rn01_00062474 predicted 611
6 SASI_Rn01_00062475 predicted 1090
7 SASI_Rn01_00062476 predicted 1061
8 SASI_Rn01_00062472 predicted 571
9 SASI_Rn01_00062477 predicted 1050
10 SASI_Rn01_00062478 predicted 752
11 SASI_Rn01_00062479 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311821 predicted 536
2 SASI_Mm02_00311822 predicted 694
3 SASI_Mm02_00311823 predicted 1283
4 SASI_Mm01_00177460 predicted 394
5 SASI_Mm01_00177461 predicted 1077
6 SASI_Mm01_00177462 predicted 1390
7 SASI_Mm01_00177463 predicted 1408
8 SASI_Mm01_00177466 predicted 1212
9 SASI_Mm02_00311824 predicted 1248
10 SASI_Mm02_00311825 predicted 916
11 SASI_Mm01_00177458 predicted 318
12 SASI_Mm01_00177459 predicted 309
13 SASI_Mm01_00177464 predicted 288
14 SASI_Mm01_00177465 predicted 1019
15 SASI_Mm01_00177467 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001701
VALIDATED
BAAT MISSION shRNA Bacterial Glycerol Stock
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001701.3-612s21c1
Sequence:CCGGACCTGGTGTCACACGAATTAACTCGAGTTAATTCGTGTGACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001701.3-1653s21c1
Sequence:CCGGGACATGGTGAATAAATCATAACTCGAGTTATGATTTATTCACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001701.3-1917s21c1
Sequence:CCGGAGTAACTTTGCAACATCATTTCTCGAGAAATGATGTTGCAAAGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001701.2-778s1c1
Sequence:CCGGGCCTTGGCTTACCATAACTATCTCGAGATAGTTATGGTAAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-1294s1c1
Sequence:CCGGCACCTGATAGAACCTCCCTATCTCGAGATAGGGAGGTTCTATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-818s1c1
Sequence:CCGGCAGAAGTAACAGATTTGGAATCTCGAGATTCCAAATCTGTTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-353s1c1
Sequence:CCGGCCCACTATAGGGCCAATGAATCTCGAGATTCATTGGCCCTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001701.2-468s1c1
Sequence:CCGGGCTATTAACAAGACTGTTGAACTCGAGTTCAACAGTCTTGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001701
VALIDATED
BAAT MISSION shRNA shRNA Plasmid DNA
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001701.3-612s21c1
Sequence:CCGGACCTGGTGTCACACGAATTAACTCGAGTTAATTCGTGTGACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001701.3-1653s21c1
Sequence:CCGGGACATGGTGAATAAATCATAACTCGAGTTATGATTTATTCACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001701.3-1917s21c1
Sequence:CCGGAGTAACTTTGCAACATCATTTCTCGAGAAATGATGTTGCAAAGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001701.2-778s1c1
Sequence:CCGGGCCTTGGCTTACCATAACTATCTCGAGATAGTTATGGTAAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-1294s1c1
Sequence:CCGGCACCTGATAGAACCTCCCTATCTCGAGATAGGGAGGTTCTATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-818s1c1
Sequence:CCGGCAGAAGTAACAGATTTGGAATCTCGAGATTCCAAATCTGTTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-353s1c1
Sequence:CCGGCCCACTATAGGGCCAATGAATCTCGAGATTCATTGGCCCTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001701.2-468s1c1
Sequence:CCGGGCTATTAACAAGACTGTTGAACTCGAGTTCAACAGTCTTGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001701
VALIDATED
BAAT MISSION shRNA Lentiviral Transduction Particles
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001701.3-612s21c1
Sequence:CCGGACCTGGTGTCACACGAATTAACTCGAGTTAATTCGTGTGACACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001701.3-1653s21c1
Sequence:CCGGGACATGGTGAATAAATCATAACTCGAGTTATGATTTATTCACCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414162    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001701.3-1917s21c1
Sequence:CCGGAGTAACTTTGCAACATCATTTCTCGAGAAATGATGTTGCAAAGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001701.2-778s1c1
Sequence:CCGGGCCTTGGCTTACCATAACTATCTCGAGATAGTTATGGTAAGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-1294s1c1
Sequence:CCGGCACCTGATAGAACCTCCCTATCTCGAGATAGGGAGGTTCTATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-818s1c1
Sequence:CCGGCAGAAGTAACAGATTTGGAATCTCGAGATTCCAAATCTGTTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001701.2-353s1c1
Sequence:CCGGCCCACTATAGGGCCAATGAATCTCGAGATTCATTGGCCCTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001701.2-468s1c1
Sequence:CCGGGCTATTAACAAGACTGTTGAACTCGAGTTCAACAGTCTTGTTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007519
BAAT MISSION shRNA Bacterial Glycerol Stock
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007519.1-1518s1c1
Sequence:CCGGCCATAGAGGAATGTCTTTGATCTCGAGATCAAAGACATTCCTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-903s1c1
Sequence:CCGGGATTGGACTTTCTATGGCTATCTCGAGATAGCCATAGAAAGTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007519.1-1659s1c1
Sequence:CCGGGCCCTATATCTACATGAATAACTCGAGTTATTCATGTAGATATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-444s1c1
Sequence:CCGGGCTATTGGGTAGATTGATAAACTCGAGTTTATCAATCTACCCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-754s1c1
Sequence:CCGGGCTCTGGCTTACTGGAACTATCTCGAGATAGTTCCAGTAAGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007519
BAAT MISSION shRNA shRNA Plasmid DNA
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007519.1-1518s1c1
Sequence:CCGGCCATAGAGGAATGTCTTTGATCTCGAGATCAAAGACATTCCTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-903s1c1
Sequence:CCGGGATTGGACTTTCTATGGCTATCTCGAGATAGCCATAGAAAGTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007519.1-1659s1c1
Sequence:CCGGGCCCTATATCTACATGAATAACTCGAGTTATTCATGTAGATATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-444s1c1
Sequence:CCGGGCTATTGGGTAGATTGATAAACTCGAGTTTATCAATCTACCCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-754s1c1
Sequence:CCGGGCTCTGGCTTACTGGAACTATCTCGAGATAGTTCCAGTAAGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007519
BAAT MISSION shRNA Lentiviral Transduction Particles
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007519.1-1518s1c1
Sequence:CCGGCCATAGAGGAATGTCTTTGATCTCGAGATCAAAGACATTCCTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-903s1c1
Sequence:CCGGGATTGGACTTTCTATGGCTATCTCGAGATAGCCATAGAAAGTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007519.1-1659s1c1
Sequence:CCGGGCCCTATATCTACATGAATAACTCGAGTTATTCATGTAGATATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-444s1c1
Sequence:CCGGGCTATTGGGTAGATTGATAAACTCGAGTTTATCAATCTACCCAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007519.1-754s1c1
Sequence:CCGGGCTCTGGCTTACTGGAACTATCTCGAGATAGTTCCAGTAAGCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks